Error message

  • Notice: Undefined variable: cmd in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 96 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).

TCONS_00001643 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001643
Unique NameTCONS_00001643
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length4713

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001643 ID=TCONS_00001643|Name=TCONS_00001643|organism=Clytia hemisphaerica|type=transcript|length=4713bp
agtgactaaaaacaaaaagaaacatgAGTAAtagattgaaaaagaaaaat
tcaccaACCAGTTTGTCATTCTCTGTAGATGTTGTGCATCTCTTGCAAAA
AGAACTTTCAGAGTTGGACTTGTCAGAAGATGTTTGCAATCAATTTAAAG
GGATAATAGCATGTCCTTCTAATGGTAAAGATCAGCTccttcttttgaaa
aagGTTTTAAAAGAGCTCAAACAAAATGAAGATGTTTTACAAAATACATT
AAAGATTCTTTGTTGTTTCTTTGTTTACTGTAAAAGCAAGCACCCACTAA
GGAGGACACTCTCAAGCTTTCTAAGTGGTATCCCAAAAGAATATGATGTT
ATCTTTCACAAAGTGATGAATCAACTCATCAATGAAACACTTCATAATAG
TTCAAAATGCCATTCCAGTGAGcTGATTGGTACTCaggataaagaaaaat
gtgaaatGGTTGCTTCTTTAATGGAGAATTTTGTAAAAGGTGATCAAGTA
ATCCAAAACAATGCAAATACGGTGCTTGCTTTTCTGTGTAGTTCCTTGAA
ACTTTTCACACAAATGGCAAGGTATGAATTAGTATTCTTTCTAAAGGTTT
ACTTAGATTCTATTCTTGTTTTGGACGGAAATATTACCAGGCTTCTTGTA
TTTCACACAAGCAatatcaacatgaaaaatataacAAGAAATctggaaaa
tataaaagaaagtcagaactcaaaaatatttatcagtATTCCAACAATGT
ACTCTGAACTATGTACAGTTTAAAGTATGATTGTTTCTagctttatgttt
tttttagaaataatgaTGGACCAGTCATTCAAACACAAATGATTCACAAT
TGTTTATTTACATTGAAAACAATTATCTCAGTTCTACAAAAATGTGAAAA
CCCAACGCTCCCGCAGAGTCTCAATGAAAACCTTGTTCTTCAAATCGCAC
AAGCCGCATCAGAGATTGTTGCTGACGAAAGCTTTTTGATTGAATGTCGA
AATGCTGCTGCAATGGTTTTTCCTGCCATCTTGCTGCATTTCTCCCGGTT
CATTGAGAACCTATTGGTTAATCTCAGCAGCGAGACTTTTTCACCTCCTG
GACATACATTAGTTGATTTCATTATCAGTACAGTTGTTGAgtttatcaaa
aatatgaagAGCATGTCTTGTGTAGTTGTTACTCTCCATGCCGTCGTTGT
CAAACTACCGAACTATTTATTAGTATCGAGCAAAAAATGTACTGTTGATC
TCTTCTTCTTGAGTCTTCAAAAGATCTGTTGTAATTGTACCGATAAGAAC
ACAATGATTCTTTCTTTCAAAACGTTTTGTCTTTGGGTGACAACAatcat
ttcaaaaaacattgatgTTGCTGTCATAACCGATTCAGCAATACCCTTTC
TCATAACTAATGTTGACCATGGTATTGATACAGTGCGACACAGTGTGACG
GCTTCATTAAAAGAATGTTTAGGGTATCtgttaaaatcaaataaaagatc
AATCGTTGAAGAATTGACTCAAAAATATGTCACCAATGACTTCAAATCAC
GTGGGAAATTAAATGTACTTTCAAGTCTTTGTGAAATATCAAGTATGAAA
TCTGTCTTGTCAACCAGATTAACTTTTCCAAAGGACTTGTTGGAACTTCT
TGGTGATGTCGACTTAGCATCACATGCCACCAATGTATATAAAACTGCTT
CTAAGAAACATTTGGAAGAGCTACAGTCTCGcaacgaatcactatctaag
tgGAATAAAACTTGGATTTCTGGTATATCTGTTGGGCTAATGAGTGATTG
TAAAGATACCAAAGCCAATATGGTCAACTATATTGTTCCAGCTATGTTAA
AAATCAACCCACTTGTTTTGAATTATTTGCTTTCAGAGTTCAACGTGAAC
TCCTCAATGGTTGAGTTTTACACGGCTGTTGTGTTTTTGAAAACAGCACG
TggtatgaaaaatgtttcacaGGAGATCTTTAAGATTAAGAGCAGCTCCG
GTGAAGGTCATATCTGGAATGGACTGATGAATTTCGATTTACTGAAAAAA
TGTATTGTACATATTGATGACCAGGTACGACTTGATGTATTATCTTTAGT
GTGCAGTTCAGTCAAAACAACCGACCATGTCAGTGAAGATGATATAGAAC
TTATCAAAGTGTTTCTTCAATACAACATGGCTGTTGAAAATCCCTCATTT
CGTCAACAAACTGTTGTTTGCTTCAAGAAATTGGTCACTCGTATATTCGC
TCATACGTACCAAATCACTAAATCACGTTCACCAAATAAAACACAAATTG
TTCAGTTATACAGTGATTTCATTGTCTGGTTTATTGCTCATGTTTTTAAC
AATCTGTACCTGGATGCACCATACTGCCAAATGTCAACCACCCTGGAGTT
GATATCACTCATCACTACCTTTCTTGGTGAAAATATCTCCTCTGATGTGA
CCAAATCTTTattgattgatgacgtcatcaaacagACATACACAACCAAG
CTTCTGAATTGCCTCCACGACACTTACGATCCAAATAGGCTTCTTGTTTT
GAGTATTTTCTCCAAGAAACCTTTATTCACTATCGAATTCTCACAAGAAA
AGCTGCTTTCCTTAGGAGATACTGCTATACAGAATTTATACTCTCCACAA
CCAGATATTTCATCCGTCGCTGCATACCAGCTTTGTTTCTTATCATTCAG
TGAAAATGTTGGAGACACGGCCAAAGACCGTTATCCATGTTTAACCATGT
TGAAGAATCTATTCCAACATCTTTTGAAGCAAGTTAGCATCATGAAGATG
AGTCTTCTCAAAGCTTCCCAGGATGCACCGATTCATGGAACTTTGTTCGC
TATTCGTTTACTANTTCTCAAAGCTTCCCAGGATGCACCCATTCATGGTA
CATTGTTTGCTATCCGGTTACTCTTTCAAACGCATCAATGGAACCTAAAC
CATTCGACGGTCAAATCTAACAGAGAGGATTTCAATCAATTCGTTAACGA
GTTTACCAAGCTAGGTTTTGACATCATTGAATTAGTTTCACCTTACGTCA
CCAACGAAGCACCTGAAGGCCAGCTATGTAACGTTAATTTATCAGATATA
TTTGAGCTATTGAGTGTGCATGGAGGCGATACAGTTTTACAAGCTCACGT
CGCTCGGATGATCCTTGTTTGTTGTTGGCGATCTATGAAAGAAGTGTCCC
TAATTCTTGGATTGTTTATCAGTCATTTTGTTGATCCTTCATCGCAGGAT
AGTTTGCTATCCAATGAGATGTTTCTTGATATGTGGGACATGTTTAATAA
CATTATGCTGAGATCAAAACACGCGGGTGCTTACGAATTAGCCAGTATTG
GTTTCCTGAAGCTTTGCACAACCTTGTGGATTTCCCGAGACGAATCTTTA
CGCACGCTACCTTTGAATGCTGTTCAAGACCTGATTGCAGATCTCACTTC
AAGCGAACCCATGGAGAATGCACAAGTCACACGCCGTAGTGCTGGGCTAC
CTTTCTACTTGCAGAGTTTGTGCTCGACTGAACCAGAGATCAATGGCAAA
GCTTCTTTTTCGTTCTTGATGAGCTCTTTATCAGAGTTATGTTTGGACCA
TCTACAAACACACGATATCAACAAAACAGTCATTGCGCTCAACGTTCTGA
GGGCTTTTTACAAAGATGCGAAAATGTGCGAGGATGTGTTCCCTTATGTT
GCGAAAGGAATCATGATCGCTTTAAATGGTTTTGGATCATCGTTATGGCC
TATCCGAAACTCATGCACTCTTTTGTTCAGTTCCCTAATGCAGCGGATCT
TCGGTGTCAAGAAggtcaaaatgaccggacgtgAGTTCTTCTCACGCTAT
CCTCAACTGTATCCTTACCTGGTCGAGAAAACGAAGCTAATGAGCGTCAC
CAATGAATCAAATACACAACTCCATCCAAGTGTGTTCCCCATCCTTCTCT
TGCTTTCGCACCTTTATCCGTCGACTATCGAAGGGGCCGATTCACTCATG
AAATTGGATGTCTTCCTGGAGTCTATTCTCAGTTTAAGCGGCAACCCTGT
ATACAAAACTCGAACGATGACAGCAAACGCTCTTGTACCACTGGTCTCCC
TGGAAAGAGCTGAATCAGTCACAAAGAGGATTCTGGGAGATATCAAACGT
CATTACGAAGGAACTATTAACCAGAATGCAATTCACGGATGCTTGTTACA
GTTATTCAGACTGATTAAAAAATGGGCTTCTTTACCTTTGAGACAGGTTA
ATGTTGTCTTCTTGATGAAACTCGTTCTAAAAGAGTCTGTTGGATTGTTC
AACGATTCAAATGTAAACCCGATCTCCAAGAAATGTCTACTCGATATCGT
GATTCTGTTGCTACAAACAAATACCGGATTTAATGACGCAGAATCCAACA
GTATCATTGAAGCCTACGCAAAGACAGGTGTTTTGCTGTTAATCTCTCAC
AAAAAGAAAGACATTAACGAGAATACATCAGCTGGATACGCCTTACTACT
GCGTGGTGTAACAGCCTTCATAATGGAGTTATTAAAAGCCGAACTACTTG
CATCAAATCTTGTCAAGTTATTCAACGCCAAAGATACCACGGTGAAATCT
GTTGTTGATGTTTTTCTGTACTTGTTGGGGCTAAGACATGCTGATGTTGT
TGGTGAAATTACTGCCAGGAAAGATGACGTGAAATTATCTTCGTTCGAAG
GACTGGCTAGCGG
Run BLAST on NCBI

transcript from alignment at sc0000011:125927..136503-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001643 ID=TCONS_00001643|Name=TCONS_00001643|organism=Clytia hemisphaerica|type=transcript|length=10577bp|location=Sequence derived from alignment at sc0000011:125927..136503- (Clytia hemisphaerica)
AGTGACTAAAAACAAAAAGAAACATGAGTAATAGATTGAAAAAGAAAAAT TCACCAACCAGTTTGTCATTCTCTGTAGATGTTGTGCATCTCTTGCAAAA AGAACTTTCAGGTAAAATTACTTTTTTCTCATAAAAGTGTCCTCCCAGTA ATCTGATGATTTTGTAGTTGTTTCTGCAATAGAATGAGTCAGCTTTGCTA TTATAAAAACATAAAATGGATGGCAAGGGGATTCAAACAAGAAAACCTGG GGTTCTGATGAAGATGTCTTAGTCTCTTTAGCCTTCCTACTTAAAATAAA ATTAACAAAAATTACAGTCTGTTACAGTCTGTATTATAATATCTCATAAT ATTTCTTTTTTTCATAGAGTTGGACTTGTCAGAAGATGTTTGCAATCAAT TTAAAGGGATAATAGCATGTCCTTCTAATGGTAAAGATCAGCTCCTTCTT TTGAAAAAGGTATGTTCAAAGGTTTTCGATATGATAAAGCTGACCTAAGC ATGACACTAGGGCTGACCAATCGGATAAACTATGATTACCCTATTTCAAA CTACATCTGAGGGCTCAATCTCTTATCTTAAGGAAGTAAAGGTTTGGTTT GTTTGGACCATATGTTCATATTTTTACCAATAAACATTTTCTGAATTTCT GATTTAGGTTTTAAAAGAGCTCAAACAAAATGAAGATGTTTTACAAAATA CATTAAAGATTCTTTGTTGTTTCTTTGTTTACTGTAAAAGCAAGCACCCA CTAAGGAGGACACTCTCAAGGTAATAATGTTTTTAAGAATATTGTTATGC TAATTTCATAATAATTTCATTGAAAATGAAGACAGACCCCTTACATACAT ACTCCTTCTCATAATGTCATGTATGATGTAGCTAATAGCGCTGGTTCTGA CTCTTTTCTGTTATATTGTTGGCAAGAGTCAGATAACACCTACACATCCC TTTTCTCATAATGTTACGATACAATTAAACCTTTTGTTGAGAAATTTCTA TCTTTACATCTGTAAAAGATTTTTTGTCCTTTTAACATGATATAAAAATT CCCAAAAGTCTAATTATAATTGATTTCTTGAGATTTCTAAAGCAATCAAA ATACAAGCACAAAACTGTGCCAGGTCTCCCCTGGCAACCAAACTGTTTCT GAAGCCATTGCCAAAAAGAACGACAAATTTCATATTTTGCTAACCACAAC CCCGACCAAAAGTGACTGTACCACCCCTCCTAGCGATTCATTTTTCTTTG TTTATCACGGGAATTAACTACATGTGGTTTAAAAGAACGACAAGTTACGC ATGCGTGTTATTAATGCAGGAATTGCAAGATGCACCAAATCAGAAAGATT GGATTCAACAAACAGGTTTTTGTTGCCAAGTTTTAAGAATTGTATGATGA TAAGTAAAAGTAACTTGGTTTTGTAAAATTTATTGTTTCTCTCATTGATA TTTTGATTTTAACCCTTTATTTTAAGCTTTCTAAGTGGTATCCCAAAAGA ATATGATGTTATCTTTCACAAAGTGATGAATCAACTCATCAATGAAACAC TTCATAATAGTTCAAAATGCCATTCCAGTGAGGTATATTTTCGTATTTAT CTTGATTAATATAAGTTTATAGGAATTTTTGGTTAACGCATATTTTATGT GATGTTATTCTGGCTAACTTCCATTTATTATTTATTTAGCTGATTGGTAC TCAGGATAAAGAAAAATGTGAAATGGTTGCTTCTTTAATGGAGAATTTTG TAAAAGGTGAGTTGTTATATTATTGAGGGGACCTTAGTTAATGATGATCC TGGATCCCAAAATATTGATCGTTTATAAAAATGTAGAAAGTTATACAGAA GTAGGTTAAGAATAAGCTGAGTCTTGTTTGATATTTTTCAACCAAACTTT TCATTCAGTTAAGTTTGTTCTATCCATAAATAATACAAATTGTTTGTCTT CAATGATGCCTTTTTAATATACCTTTATAAAGGAATTATAACCGCTTGTT ATTTTTTTGTAGGTGATCAAGTAATCCAAAACAATGCAAATACGGGTAAG AGTTGGGAAAATTTAATGTTTTTAACTGACCTGAATTTATTGAATTTATT CATTTTCCAACGGTTCTGGTGGTTGGTCAGAAGACAACATGAGAGCAACT GTATTCACTTCATATGTTATTTATCGTAAAAAATAGGAATATATTTCAAA AAATTGACAAAAGCTGATTAAAAAGTATTTTGAGAAGAGTCTTTTTCTTG ACAAAGTTAAAGAATGGTTTTCAAGCTTTGTTTTACTCTTTCTTTTAGTG CTTGCTTTTCTGTGTAGTTCCTTGAAACTTTTCACACAAATGGCAAGGTA TGAATTAGTATTCTTTCTAAAGGTTTACTTAGATTCTATTCTTGTTTTGG ACGGAAATATTACCAGGCTTCTTGTATTTCACACAAGCAATATCAACATG AAAAATATAACAAGAAATCTGGAAAATATAAAAGAAAGTCAGAACTCAAA AATATTTATCAGTATTCCAACAATGTACTCTGAACTATGTACAGTTTAAA GTATGATTGTTTCTAGCTTTATGTTTTTTTTAGAAATAATGATGGACCAG TCATTCAAACACAAATGATTCACAATTGTTTATTTACATTGAAAACAATT ATCTCAGTTCTACAAAAATGTGAAAACCCAACGCTCCCGCAGAGTCTCAA TGAAAACCTTGTTCTTCAAATCGCACAAGCCGCATCAGAGATTGTTGCTG ACGAAAGCTTTTTGATTGAATGTCGAAATGCTGCTGCAATGGTTTTTCCT GCCATCTTGCTGCATTTCTCCCGGTTCATTGAGAACCTATTGGTTAATCT CAGCAGCGAGACTTTTTCACCTCCTGGACATACATTAGTTGATTTCATTA TCAGTACAGTTGTTGAGTTTATCAAAAATATGAAGAGCATGTCTTGTGTA GTTGTTACTCTCCATGCCGTCGTTGTCAAACTACCGAACTATTTATTAGT ATCGAGCAAAAAATGTACTGTTGATCTCTTCTTCTTGAGTCTTCAAAAGA TCTGTTGTAATTGTACCGATAAGAACACAATGATTCTTTCTTTCAAAACG TTTTGTCTTTGGGTGACAACAATCATTTCAAAAAACATTGATGTTGCTGT CATAACCGATTCAGCAATACCCTTTCTCATAACTAATGTTGACCATGGTA TTGATACAGTGCGACACAGTGTGACGGCTTCATTAAAAGAATGTTTAGGG TATCTGTTAAAATCAAATAAAAGATCAATCGTTGAAGAATTGACTCAAAA ATATGTCACCAATGACTTCAAATCACGTGGGAAATTAAATGTACTTTCAA GTCTTTGTGAAATATCAAGTATGAAATCTGTCTTGTCAACCAGATTAACT TTTCCAAAGGACTTGTTGGAACTTCTTGGTGATGTCGACTTAGCATCACA TGCCACCAATGTATATAAAACTGCTTCTAAGAAACATTTGGAAGAGCTAC AGTCTCGCAACGAATCACTATCTAAGTGGAATAAAACTTGGATTTCTGGT ATATCTGTTGGGCTAATGAGTGATTGTAAAGATACCAAAGCCAATATGGT CAACTATATTGTTCCAGCTATGTTAAAAATCAACCCACTTGTTTTGAATT ATTTGCTTTCAGAGTTCAACGTGAACTCCTCAATGGTTGAGTTTTACACG GCTGTTGTGTTTTTGAAAACAGCACGTGGTATGAAAAATGTTTCACAGGA GATCTTTAAGATTAAGAGCAGCTCCGGTGAAGGTCATATCTGGAATGGAC TGATGAATTTCGATTTACTGAAAAAATGTATTGTACATATTGATGACCAG GTATTACTCAAAATTATTTCTTATACGATAACGCTGCCAATGATTAATAC CGCATTCTATTGTAAAGTTTTTGATAAGCTTGACTTTTTTTATTACTACT CGATTTATATTACCTTATATTTAGATGTCCTATTAACGATCCTTCGCCAG TTTGTTACTCAGCCCATAGATTTTACTAGAACTCTCATTGATCTCAAAAC CCCGGGGGCTAGTTCCGAAACTCCTTGATGGGAAACGCAGCAACTTATTT CCAAACAAAGTTTATAAATGTGGGGTAAACTTAAGGCTTCACTTTTTTTT TGCTTGATAAGGGTTGAAGATTCTCATCTAGCCCCTTTAGGGCTTCAAAC GCAATGAGTACTCTCCATGCTGGATCGTTTTTAAGAATATTGCTCTAAAC AGCCTAACATTCGATTTAAACCCATACATATTCTATAAACTTGAACTCCA GAATAGGGAATATTATCAATTCTCACTATCTTCCATTTTTCCCACAGGTA CGACTTGATGTATTATCTTTAGTGTGCAGTTCAGTCAAAACAACCGACCA TGTCAGTGAAGATGATATAGAACTTATCAAAGTGTTTCTTCAATACAACA TGGCTGTTGAAAATCCCTCATTTCGTCAACAAACTGTTGTTTGCTTCAAG AAATTGGTCACTCGTATATTCGCTCATACGTACCAAATCACTAAATCACG TTCACCAAATAAAACACAAATTGTTCAGTTATACAGTGATTTCATTGTCT GGTTTATTGCTCATGTTTTTAACAATCTGTACCTGGATGCACCATACTGC CAAATGTCAACCACCCTGGAGTTGATATCACTCATCACTACCTTTCTTGG TGAAAATATCTCCTCTGATGTGACCAAATCTTTATTGATTGATGACGTCA TCAAACAGACATACACAACCAAGCTTCTGAATTGCCTCCACGACACTTAC GATCCAAATAGGCTTCTTGTTTTGAGTATTTTCTCCAAGAAACCTTTATT CACTATCGAATTCTCACAAGAAAAGCTGCTTTCCTTAGGAGATACTGCTA TACAGAATTTATACTCTCCACAACCAGATATTTCATCCGTCGCTGCATAC CAGCTTTGTTTCTTATCATTCAGTGAAAATGTTGGAGACACGGCCAAAGA CCGTTATCCATGTTTAACCATGTTGAAGAATCTATTCCAACATCTTTTGA AGCAAGTTAGCATCATGAAGATGAGTCTTCTCAAAGCTTCCCAGGATGCA CCGATTCATGGAACTTTGTTCGCTATTCGTTTACTANTTCTCAAAGCTTC CCAGGATGCACCCATTCATGGTACATTGTTTGCTATCCGGTTACTCTTTC AAACGCATCAATGGAACCTAAACCATTCGACGGTCAAATCTAACAGAGAG GATTTCAATCAATTCGTTAACGAGTTTACCAAGCTAGGTTTTGACATCAT TGAATTAGTTTCACCTTACGTCACCAACGAAGCACCTGAAGGCCAGCTAT GTAACGTTAATTTATCAGATATATTTGAGCTATTGAGTGTGCATGGAGGC GATACAGTTTTACAAGCTCACGTCGCTCGGATGATCCTTGTTTGTTGTTG GCGATCTATGAAAGAAGTGTCCCTAATTCTTGGATTGTTTATCAGTCATT TTGTTGATCCTTCATCGCAGGATAGTTTGCTATCCAATGAGATGTTTCTT GATATGTGGGACATGTTTAATAACATTATGCTGAGATCAAAACACGCGGG TGCTTACGAATTAGCCAGTATTGGTTTCCTGAAGCTTTGCACAACCTTGT GGATTTCCCGAGACGAATCTTTACGCACGCTACCTTTGAATGCTGTTCAA GACCTGATTGCAGATCTCACTTCAAGCGAACCCATGGAGAATGCACAAGT CACACGCCGTAGTGCTGGGCTACCTTTCTACTTGCAGAGTTTGTGCTCGA CTGAACCAGAGATCAATGGCAAAGCTTCTTTTTCGTTCTTGATGAGCTCT TTATCAGAGTTATGTTTGGACCATCTACAAACACACGATATCAACAAAAC AGTCATTGCGCTCAACGTTCTGAGGGCTTTTTACAAAGATGCGAAAATGT GCGAGGATGTGTTCCCTTATGTTGCGAAAGGAATCATGATCGCTTTAAAT GGTTTTGGATCATCGTTATGGCCTATCCGAAACTCATGCACTCTTTTGTT CAGTTCCCTAATGCAGCGGATCTTCGGTGTCAAGAAGGTCAAAATGACCG GACGTGAGTTCTTCTCACGCTATCCTCAACTGTATCCTTACCTGGTCGAG AAAACGAAGCTAATGAGCGTCACCAATGAATCAAATACACAACTCCATCC AAGTGTGTTCCCCATCCTTCTCTTGCTTTCGCACCTTTATCCGTCGACTA TCGAAGGGGCCGATTCACTCATGAAATTGGATGTCTTCCTGGAGTCTATT CTCAGGTATCGATTTTTCCATTAGAGTAAAATTTTCTTTAACTATTGCAC GACTTGAAAAGCGAAACAATACACGTGCCACGTGTATTATAAATAGGTTT AAGGTGGCACCTAAAGAATTTCGGCGAACCTATTTAGAGCGAACGTAGAT CTTAGAGGTTTTCAATCGTGGATCGAAAACTTCTAACTTCCACTTCTTAG TTTTCTTAACCATTCAAATAACTGCAAAAGAAATATACTAGGTGATTGCC CAGTAGACCGAAGCTCTAAGTCATAGTTCCAATTCAACTAGGTGATCCGA TAAAGCTGGATAAAGTACACAACTTAAAACTACCCCTTGTCTTTGTTTGT AGTTTAAGCGGCAACCCTGTATACAAAACTCGAACGATGACAGCAAACGC TCTTGTACCACTGGTCTCCCTGGAAAGAGCTGAATCAGTCACAAAGAGGA TTCTGGGAGATATCAAACGTCATTACGAAGGAACTATTAACCAGAATGCA ATTCACGGATGCTTGTTACAGTTATTCAGACTGATTAAAAAATGGGCTTC TTTACCTTTGAGACAGGTTAATGTTGTCTTCTTGATGAAACTCGTTCTAA AAGAGTCTGTTGGATTGTTCAACGATTCAAATGTAAACCCGATCTCCAAG AAATGTCTACTCGATATCGTGATTCTGTTGCTACAAACAAATACCGGATT TAATGGTATGTTAACTACCATAGAGCAGCTTTTGACCTAGCCTGGGGTCC ACTTAATAGTCCAGGAGCCAAACCCAAAAAATGGCATTTTGCTTAACCCA AGATTCTACAGGATAAACTATACATTTTTGGAATCCTCAACTATCCTAGT TTTGGAAATGGTCGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAT TGACCAGGAGTTAGCTTTGGGGACCGACCATTTCCAAAACTAGGATAGTT GAGGATTCCAAAAATGTATAGTTTATCCTGTAGAATCTTGGGTTAAGGAA AAGTGCTTATTTAAGGAGATATAGGATTTGGCTCCCGGACTATAAAGCTT TTTTATAGACTGGATGGTGCGATTAAGTGGCCTGGTAGTATATAGTAATA TGCTTTTGCCTACGCCAGATTTTCGTTGTTTTTGCCAGGTAAAAAAAGAA CGAAGCAATGTTTTTATTTGAAAATAAGTGATTCAAAATCTGTTATTGAT GTTTGTTTCTCATTCTTAATTTTATTTTTCAACTTCAAGTAGCTTTTTTG TTATTTGGATTTCAAATATTTTTTTTCCAAAATGGCGACCTCGTCAAATG CTCCTAGTCTACTTCACTGGACTCAGCGTCATGAAAAATTATCGAAAAGC AAAGTTCAGCCAGAAGTAGACTCTAGTCTACTTTTGATCAGAGGCACTTC TAACTTGATTTTACATTACAGTATACTTTGTCGACATTATAATTTTCAAA ATTGTTTTAAGTAACTTTCTCAAATGTCCTTAAGACTTTAGAGGTTTTTC TCCCGTTAGGAATCCTAATTGTGAACTTTTTCTGAGGAGAAACCACTGGA GGTAAGTGGCTCTAATTGTATGTATTTATGACAATCTCATTGTTTTCAGA CGCAGAATCCAACAGTATCATTGAAGCCTACGCAAAGACAGGTGTTTTGC TGTTAATCTCTCACAAAAAGAAAGACATTAACGAGAATACATCAGCTGGA TACGCCTTACTACTGCGTGGTGTAACAGCCTTCATAATGGAGTTATTAAA AGCCGAACTACTTGCATCAAATCTTGTCAAGTTATTCAACGCCAAAGATA CCACGGTGAAATCTGTTGTTGATGTTTTTCTGTACTTGTTGGGGCTAAGA CATGCTGATGTTGTTGGTGAAATTACTGCCAGGAAAGATGACGTGAAATT ATCTTCGTTCGAAGGACTGGCTAGCGG
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000856XLOC_000856Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001643-exon-sc0000011-1575043694:136393..136503TCONS_00001643-exon-sc0000011-1575043694:136393..136503Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:136045..136136TCONS_00001643-exon-sc0000011-1575043694:136045..136136Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:135734..135846TCONS_00001643-exon-sc0000011-1575043694:135734..135846Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:134922..135027TCONS_00001643-exon-sc0000011-1575043694:134922..135027Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:134748..134814TCONS_00001643-exon-sc0000011-1575043694:134748..134814Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:134459..134491TCONS_00001643-exon-sc0000011-1575043694:134459..134491Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:132654..134205TCONS_00001643-exon-sc0000011-1575043694:132654..134205Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:130199..132156TCONS_00001643-exon-sc0000011-1575043694:130199..132156Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:129499..129851TCONS_00001643-exon-sc0000011-1575043694:129499..129851Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1575043694:125927..126254TCONS_00001643-exon-sc0000011-1575043694:125927..126254Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:136393..136503TCONS_00001643-exon-sc0000011-1510915933:136393..136503Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:136045..136136TCONS_00001643-exon-sc0000011-1510915933:136045..136136Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:135734..135846TCONS_00001643-exon-sc0000011-1510915933:135734..135846Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:134922..135027TCONS_00001643-exon-sc0000011-1510915933:134922..135027Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:134748..134814TCONS_00001643-exon-sc0000011-1510915933:134748..134814Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:134459..134491TCONS_00001643-exon-sc0000011-1510915933:134459..134491Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:132654..134205TCONS_00001643-exon-sc0000011-1510915933:132654..134205Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:130199..132156TCONS_00001643-exon-sc0000011-1510915933:130199..132156Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:129499..129851TCONS_00001643-exon-sc0000011-1510915933:129499..129851Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1510915933:125927..126254TCONS_00001643-exon-sc0000011-1510915933:125927..126254Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:136393..136503TCONS_00001643-exon-sc0000011-1491911889:136393..136503Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:136045..136136TCONS_00001643-exon-sc0000011-1491911889:136045..136136Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:135734..135846TCONS_00001643-exon-sc0000011-1491911889:135734..135846Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:134922..135027TCONS_00001643-exon-sc0000011-1491911889:134922..135027Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:134748..134814TCONS_00001643-exon-sc0000011-1491911889:134748..134814Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:134459..134491TCONS_00001643-exon-sc0000011-1491911889:134459..134491Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:132654..134205TCONS_00001643-exon-sc0000011-1491911889:132654..134205Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:130199..132156TCONS_00001643-exon-sc0000011-1491911889:130199..132156Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:129499..129851TCONS_00001643-exon-sc0000011-1491911889:129499..129851Clytia hemisphaericaexon
TCONS_00001643-exon-sc0000011-1491911889:125927..126254TCONS_00001643-exon-sc0000011-1491911889:125927..126254Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:125927..136503 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0.439785 0.340421 0 0.202728 0 0 0.361878 0 0 0 0 0 0 0 0 0 0 0 0 0 0.212686 0 0 0 0.432142 0 0.439978 0 0
Blast
BLAST of TCONS_00001643 vs. Swiss-Prot (Human)
Match: THADA (Thyroid adenoma-associated protein OS=Homo sapiens GN=THADA PE=1 SV=1)

HSP 1 Score: 353.984 bits (907), Expect = 3.417e-99
Identity = 295/1063 (27.75%), Postives = 508/1063 (47.79%), Query Frame = 2
Query: 1376 ITDSAIPFLITNVDHGIDTVRHSVTASLKECLG-YLLKSNKRSIVE-----ELTQKYVTNDFKSRGKLNVLSSLCEISSMKSVLSTRLTFPKDLLELLGDVDLASHATNVYKTASKKHLEELQSRNESLS---KWNKTWISGISVGLMSDCKDTKANMVNYIVPAMLKINPLVLNYLL----SEFNVNSSMVEFYTAVVFLKTARGMKNVSQEIFKIKSSSGEGHI------WNGLMNFDLLKKCIVHIDDQVRLDVLSLVCSSVKTTDHVSEDDIELIKVFLQYNMAVENPSFRQQTVVCFKKLVTRIFAHT---YQITKSRSPNKTQ----------IVQLYSDFIVWFIAHVFNNLYLDAPYCQMXXXXXXXXXXXXXXGENISSDVTKSLLIDDVIKQTYTTKLLNCLHDTYDPNRLLVLSIFSKKPLFTIEFSQE-KLLSLGDTAIQNLYSPQPDISSVAAYQLCFLSF------------SENVGDTAKDRYPC------LTMLKNLFQHLLKQVSIMKMSLLKASQDAPIHGTLFAIRLLXLKASQDAPIHGTLFAIRLLFQTHQWNLNHSTVKSNREDFNQFVNEFTKLGFDIIELVSPYVTNEAPEG-------------------QLCNVNLSDIF---ELLSVHG---------------------GDTVLQAHV-ARMILVCCWRSMKEVSLILGLFISHFVD---PSSQDSLLSNEMFLDMWDMFNNIMLRSKHAGAYELASIGFLKLCTTLWISRDESLRTLPLNAVQDLIADLTSSEPMENAQVTRRSAGLPFYLQSLCSTEPEINGKAXXXXXXXXXXELCLDHLQTHDINKTVI---ALNVLRAFYKDAKMCEDVFPYVAKGIMIALNGFGSSLWPIRNSCTLLFSSLMQRIFGVKKVK--------MTGREFFSRYPQLYPYLVEKTKLMSVTNESN---TQLHPSVFPILLLLSHLYPSTIEGADSLMKLDVFLESILSLSGNPVYKTRTMTANALVPLVSLERAESVTKRILGDIKRHYEGTINQNAIHGCLLQLFRLIKKWA 4228
            I    + ++ T+ +H +D +RH      K  L  + L       V      ELT+  +  ++  +GK   L  L E   ++ +L+   T P  +LE++GD  L  +A+++ +T  + H   L+S+    S   +W++TW+S +   L     D K+ +++Y +P +L  +P  L Y++    +  +  +   + + ++    + RG         +I  +   GH+      W  L++   +K+ ++H   QVR+D L L+C S ++T+ VS ++++ I+ F+ YN+  ++P  RQQ     KKL  RI   +   Y++ +S+S  + +           +Q Y +F+      +F  L+  + Y    + L ++  I            T   L  D+    + T L+ C   T++  ++L   +  K     + F    KL  L   A++   S +P     A+Y L FL +            ++ V     DR         L ++K L ++L ++VS  + SLL+A+   P++G +  I     K S        L +++L+                  ++   V +   + + +  +VSP + + +PEG                   ++   + +D F   ++L  H                      G  V    V A+M+LVCCWRSMKEV+L+LG+          P S D LL+ E   ++ D F   +L+S+H GA+ELA  GF+KL   L    + SL+ LP   +  ++ ++  S+P      TRRSAG+PFY+Q+L ++EP+   K     L  ++ EL      T DI  TV    ALN+LRA ++D ++ E++ PYVA G   A+ GF S +W +RNS TLLFS+L+ RIFGVK+ K        MTGREFFSR+P+LYP+L+++ + ++ T +S+      HPS+F +LL+L  LY S ++G  S + +  F+  I+    +PVY +R M A ALVP V ++   +  + +L  +    +    QN IHG LLQ+F L++ ++
Sbjct:  388 IVGRLLEYVYTHWEHPLDALRHQTKIMFKNLLQMHRLTVEGADFVPDPFFVELTESLLRLEWHIKGKYTCLGCLVECIGVEHILAIDKTIPSQILEVMGDQSLVPYASDLLETMFRNHKSHLKSQTAESSWIDQWHETWVSPLLFILCEGNLDQKSYVIDYYLPKLLSYSPESLQYMVKILQTSIDAKTGQEQSFPSLGSCNS-RGALGALMACLRI--ARAHGHLQSATDTWENLVSDARIKQGLIHQHCQVRIDTLGLLCESNRSTEIVSMEEMQWIQFFITYNLNSQSPGVRQQICSLLKKLFCRIQESSQVLYKLEQSKSKREPENELTKQHPSVSLQQYKNFMSSICNSLFEALFPGSSYSTRFSALTILGSIAEVFHVPEGRIYTVYQLSHDIDVGRFQT-LMECFTSTFEDVKILAFDLLMKLSKTAVHFQDSGKLQGLFQAALELSTSTKPYDCVTASYLLNFLIWQDALPSSLSAYLTQQVACDNGDRPAAVVERNTLMVIKCLMENLEEEVSQAENSLLQAAAAFPMYGRVHCITGALQKLS--------LNSLQLV-----------------SEWRPVVEKLLLMSYRLSTVVSPVIQSSSPEGLIPMDTDSESASRLQMILNEIQPRDTNDYFNQAKILKEHDSFDMKDLNASVVNIDTSTEIKGKEVKTCDVTAQMVLVCCWRSMKEVALLLGMLCQLLPMQPVPESSDGLLTVEQVKEIGDYFKQHLLQSRHRGAFELAYTGFVKLTEVLNRCPNVSLQKLPEQWLWSVLEEIKCSDPSSKLCATRRSAGIPFYIQALLASEPK---KGRMDLLKITMKELISLAGPTDDIQSTVPQVHALNILRALFRDTRLGENIIPYVADGAKAAILGFTSPVWAVRNSSTLLFSALITRIFGVKRAKDEHSKTNRMTGREFFSRFPELYPFLLKQLETVANTVDSDMGEPNRHPSMFLLLLVLERLYASPMDGTSSALSMGPFVPFIMRCGHSPVYHSREMAARALVPFVMIDHIPNTIRTLLSTLPSCTDQCFRQNHIHGTLLQVFHLLQAYS 1418          
The following BLAST results are available for this feature:
BLAST of TCONS_00001643 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
THADA3.417e-9927.75Thyroid adenoma-associated protein OS=Homo sapiens... [more]
back to top