Error message

  • Notice: Undefined variable: cmd in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 96 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).

TCONS_00001362 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001362
Unique NameTCONS_00001362
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length653

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001362 ID=TCONS_00001362|Name=TCONS_00001362|organism=Clytia hemisphaerica|type=transcript|length=653bp
CTACCGCGCCTGGTATTCCCTATGTTCTAGAGATCTGGCCTTCAGGAAAA
GGAAGCCCTATCCATAATCATGGAGGAGCATGTGCAATAATTAAAGTGCT
ATTTGGTAGAATCACTTGCAACATCTACAACAAGATCACACAGCCACCGG
AACAAACAGAAATGCAACCTTTGACCAGATTTGATCTCAATGAAGAGCAA
ATGACCTGGATAGGCCCCAACTGGTATCAAACGCATCGCTTACACAACAA
CACTGATGATTTCTGCGCAACCATACAATGCTATCGATATGACTTCAATG
ATGCAATTCACTGGCCCAATTTCGATTATGTGGGTTTTGTAGAAGACAAA
GAAAAATACGAGTTGGAAGAATTCTATCCAGATAGCGATTTCACGTTCGT
TAATTTGAGACGAACTGTTCTTGACGAGtttcaaaaattcttagaaGGAT
GAGTTATGATTTTAACTTTCCTGCAAAGATTGCAGTGCTTTcaagtaaat
aaatattttgttagCGTTTTTTTTTCACAGTAAACAGTAAACCATGTTAC
ATTTTAAAACGTTATACTGTTGAACCCCCATGTAATTTGTATTTAATAAA
TTGAAAGACCTATGTGTGAATCGAAAAAAAACTTGATAATTTCacaatta
aaa
Run BLAST on NCBI

transcript from alignment at sc0000010:598342..604106+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001362 ID=TCONS_00001362|Name=TCONS_00001362|organism=Clytia hemisphaerica|type=transcript|length=5765bp|location=Sequence derived from alignment at sc0000010:598342..604106+ (Clytia hemisphaerica)
CTACCGCGCCTGGTATTCCCTATGTTCTAGAGATCTGGCCTTCAGGTAAG GAGATGGTTCAGTGCAGCTCGCTTTGGCAAGTTAACCGTAGTGGTAGTAA CATGTTTTCAATATTTAAGAGGGAGATCATGAATCGCATTACTCGTTGAT GTGTCTTGATGTATACCGGATGGTCCAAAGAAAGTTTccataaattcaaa atttatgattttcatCACAAAGTGTTAGAACAACTATCCACCGCACAAAC AGATAGGGTTGATTCTACCAGCGTCGATGAAtatcaatttctgaaaattt tccgATAGAGTGACTTCAGACATCGGTGGTCTCTCGCCCCTGGGAAACTA TAACTATACTATAAAAGTAACTTAATTCNACTTTTTCAGATTATACGCTC AtatgttttcttcttttatattaCTAACTGCGAAATAAATTAGCATGGTC AGGGGATTGTCCAGGGTTGATGAATCTATATTTGCTTTCTTTCTCAGGAA AAGGAAGCCCTATCCATAATCATGGAGGAGCATGCGCTATCATTAAAGTG CTATTTGGTAGAATCACTTGCAACATCTACAACAAGATCACACAGCCACC AGAACAAACAGAAATGCAACCTTTGACCAGATTTGATCTCAATGAAGAGC AAATGACCTGGATAGGCCCCAACTGGTATCAAACGCATCGCTTACACAAT AACACTGATGATTTCTGCGCAACCATACAATGCTATCGATATGACTTCAA TGATGCAATTCGCTGCCCAAATTTCCATTATGTGGGTTTTGTAGAAGGCA AAGAAAAATATGAGTTGGAAGAATTCTATCCAGATAGCGATTTCACGTTC GTTAATTTGAGACGAACTGTTCTTGACGAGTATCAAAAATTCTTGGAAGG CTGAGTagtgattttgattttattttttttctgtaaaagtgttgttttta atcaaattttatttaGCCCTCTTAGCCGAGGGTAATCTAAAAGATATTTT AGAGCTTCTACagtttaaccctatttttatcagtgGGGGTGTTTTCCATC AGCCTGGCATTTATTTGCTAATAGCTTTGTATTTGTCTGATACTTTCGTA CACAAGTCGTTTCTTTTGTCAGTAATGAGTTGTGGTAGCGAACCCCAAAT GAACTTTCTGGTGCGAACCCTGAAACAAGATTTTGACAAGATAGTCTACC TGCAGGCTTTTATTGGCACGGCCAGTAAAAGAGTCGCGGTATTTCAGCAC GGTAAAATAAAAAGACGCAATTGTTAAAGAGTTAACGACTTAAAAGTATC AAAGAGTTGGACAATAAAAGGCTAtttcatatttaaaaaaaaatcaaatt tgtttaaTACCGATTTAGTTGTATGAAAAGAGATTCTCGAAAAACATTAT CAGTGATTCGACAAAACATACTTTCACCGAAGTTTCTTTTAAGATAATCC TATAGAGTCTGTGTAAAACATGATAAGGCAAGTGGGTAAAACGATATGAA CCTTTTGTCGGGAGATGATGATTCGTATGACAATCTCGTAATTAGGAACT TATAGTATTTTTATAGACTTAAAAAAGCTTTGTTAGTTCTATGTTGTTTT AATGATCTTTGATGTTTAGTAAattcaaacaaacaaacgaAAATACTAGT AAGGAAATAATTCTCGTTCCAACACaatcttacacgtttttttataagaa caaactatataagaacataaggcttcgatgaccaaaatgttaagaataag ttaagaacattttaaggcttcgcggactcaaAAACAGCCAATtacttagg aaaatggacaaaaatacataaaaattgggggaaaataagaacatgttaag gacattttgaaactcaaaaagttaagaacatctgaaggcttcaaaaaatt tggatgttcttataaaaaaacgtgtatctgtttgaaagaaaattagttta CTGGTAATAGACAAGCTCCTCTTCTTTCCTAGAAAGGTGTTTTACATTCT GcgaaaaaaaaaacctaaaaGTTTTTGCTGACTCAAACAGTGATTTGAAT CTGTGACTATCTTGTGACTATCAGCCTCTTTCCAATCCTTTATATAAAGC CGCCATAATGTGTACgaatcttcaaaactactttactTGTAAACCGCGAG GGAGACAATTTAAAACGTGCATCATTCAACGAAAACGGCAACTAAGTTTT CAAGAGAAACTGTTGTTAGAAGCTGAGCTGTTTAAACCAAGGTGAGCTAT GCCTCGAAGAAGGACTGCTGTCTTTCCCGTAAACGGTCAAGGGACTCTAG TCTATACCGTTCGTAAGAAGAGTCAATTCACCATCTACATAACACCTGAC AAACAAAAGGTACCAAAAAGCTTAGATTTCGATAGTGAATTCTCAGAGTT TGAAGAGGAGCAAAGTTTTGATACGGAGAACTACATCTCGTTGACTGTTG GTGAGAATTTTGCACGTTTCAAACTGAAGATGCATAAAGATGGTGAAGAG AGAGTGTTGAAAGAAGAATATGGGAAGAATATTGGAATTGAACCCAAAGA ACTGGTAAGCTGTACTAATCACATCGTCTTATCTTTCGTCTAGACTTTCT CAGTCTGGTTACGTTACGTAGTTGTACTTCTATTGTTTTTACAGCTATAT ATCCTGTCCTATACGTAGCGTTCTTAAAGCTCGTGATTTTTCTTTAACGT TGGAATTTGTTTTTGGTTTTAGGTCAGTTATTGGTTCAGTTATGACCGCG ATGCACTGACCTTGAAATACGGCAAAGGGCACGTTATGACTCAAACAACA CTATTAGAGTTCCCTTTCTTGGAAGGCAAATCGAAAGGCGAAGAAGAGCA CATTCGAAAGAAGTACAATATTTTCTTCAATGCAGGTTAGACTTTGAAGT CGCTAATATTCTCAATcgacttttgttttttttccctTGGTTATCAACTT CAACTAAGTTTGGGTATaaatctgtctgtctgtctgtctgtctgtctgtc tgtctgtctgtctgtctgtctgtctgtctgtctgtcttaCAATATTGTCA CCGGATTTGTCGTTTTATTGGATTTCTCTCATATAATGTGTATGTCGGAT GGAAATGGTTATTTAGGTGTGTGACATTGGGTTGATGGATGTTTACTAAT TGGCAGTTTTTACACTAGGCTTGGATAGTGTTagttttttcttttggaaa ggtgGGTTTTGGCTTTTATCAACAGTTCTGTATTGTTTTCTTCGTGTCTC TCTGTCTGTCTGTCCGTCCGAAGATTTATGGGTTGACCAATTTTCTTACC ATTTGAGGCTAGGTTCGAATTattaattttatatttatttttctagaAGA GAAAAAATACGTGGTTGCCGAATCGGAGAAAATGGTGGAGGACGTGACAG GAGGACTGGTCAAAATCGAACAGACGTTACAATTCTATCCCAACCCTCTC GTGACTAATTTCTCACCTATCGTTAAAGATAGCTCGAAAGTCACTTTGTT CGATCTTGATCGAGATCAATTCATGTTTTCAAGTAGCCTACCACCTGCCT GTAAAGAACTCTACGATAATATCAAAGGTACGTCTAGTTAATTTCATAAC AGATCATCTATTCTGCTCCTAAAGGGATTTGGCAAATGTGCCGATCTAAC TTGGTTGTCTGTCAAAACAATTAAAACTACGTTGCTTTTTGGTTTTAATG ATTATAAGATTGACATATGATTTTGGTGTGATTGCTTTGCTTTAGCCAAT AACTGCGCACAAAATCTCATTCCGCAAACATGAGCAAATTATTTTATGGA ACCATGCCCTTTAGAGTGAATACTTGCCATGCCATGCGTTGAGTAGTAGA ATCTGCTCAGAGACTAATGTCTAGTTGACCTCTAATTTCTAACGTATTTT GATGGTCTAAAATAGACGTTACTGCTTAGAAAAATAGCCTTGACGTTTTA AATATAGGCAAGTTATTCATCAGTAGTCATTATCATCTGCNGTTGATCTC taatttctaatatttttttggtTCATGGTCTAGAATAGACGTTACTACTT AAAAAATCATTATCGTCTACAGGTCTTCAACTGGAGTTTCCAGAAGATCC TATTACGAAACTTTCAGACGCCATACGGTACAGCATCAACACACCTGGAA TGACTTTAtatgaaaagttgaaagaaaaggaagaacAGTTTGCTTACCTA CGTGTAACACTTGGGCCTGACCGCCGTACCGCACCTGGTATTCCCTATGT TCTAGAGATCTGGCCTTCAGGTAAGGAGATTTGATTATGTCCGGCATTGA CTAGTTTACTGTagtattaccttaagggaattaattttcgcgggacttat tttcACGACTAACTTCGACTgtaaattttcgcgaggatttaatttcgcga attgacgaattttttcagattttcagatttttccttAGTTTGATTACGAG ATTTTGTGTGTTTAGTAGAGTCTTATATCTTCATAactgaataaaaattt attcgaattacagagacatTCGAGAGTCATTTAAGAGAGTTTCCATTAGA TCAAAAAACTTAGAATTTTTAgcgtaaaaaaattaattttcgagaggatc aaattttgcgaatttagCGAGAGAtgagagtttgaaaattttcgcgagag attatatttcgcgaaaaagttgaaattcgcgaaaattcgcgaaatataat ccccgcgaaaatttattcccttaaggtaccatgtttgtaatttttgatag aAAGATCGGGGACCGCCATAGAGCTTGGTGTATGTGGTTTATACTATGAT TTTCATTACATGGTATAATTATTTTGATGTATCCCTCTAACAACCCTAAC TCCACAATGGGATTTGGTTTAGGCCTACCAGGGTCCAATGTCTGTCTTTG TGAGCACGTTAAATGTACTATGTACCAGTGTATCTCTCGCAGTACCTCTA cggcaataaattttgaaattagccgtagatatcgggtctgtaTTTAGACT AATGTTAACGCAATTACACCAGACATTACAAGTCAATTCTGCCATGCACT TTTTCAAATTATACGCTCAtatgttttcttcttttatattaCTAATTGCG AAATTAGCATGATCAGGGAATTGTCCAGGGTTGATGAATCTATATTTTCT TTCTCAGGAAAAGGAAGCCCTATCCATAATCATGGAGGAGCATGTGCAAT AATTAAAGTGCTATTTGGTAGAATCACTTGCAACATCTACAACAAGATCA CACAGCCACCGGAACAAACAGAAATGCAACCTTTGACCAGATTTGATCTC AATGAAGAGCAAATGACCTGGATAGGCCCCAACTGGTATCAAACGCATCG CTTACACAACAACACTGATGATTTCTGCGCAACCATACAATGCTATCGAT ATGACTTCAATGATGCAATTCACTGGCCCAATTTCGATTATGTGGGTTTT GTAGAAGACAAAGAAAAATACGAGTTGGAAGAATTCTATCCAGATAGCGA TTTCACGTTCGTTAATTTGAGACGAACTGTTCTTGACGAGtttcaaaaat tcttagaaGGATGAGTTATGATTTTAACTTTCCTGCAAAGATTGCAGTGC TTTcaagtaaataaatattttgttagCGTTTTTTTTTCACAGTAAACAGT AAACCATGTTACATTTTAAAACGTTATACTGTTGAACCCCCATGTAATTT GTATTTAATAAATTGAAAGACCTATGTGTGAATCGAAAAAAAACTTGATA ATTTCacaattaaaa
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000729XLOC_000729Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001362-exon-sc0000010-1491911889:598342..598386TCONS_00001362-exon-sc0000010-1491911889:598342..598386Clytia hemisphaericaexon
TCONS_00001362-exon-sc0000010-1510915933:598342..598386TCONS_00001362-exon-sc0000010-1510915933:598342..598386Clytia hemisphaericaexon
TCONS_00001362-exon-sc0000010-1575043694:598342..598386TCONS_00001362-exon-sc0000010-1575043694:598342..598386Clytia hemisphaericaexon
TCONS_00001362-exon-sc0000010-1491911889:603499..604106TCONS_00001362-exon-sc0000010-1491911889:603499..604106Clytia hemisphaericaexon
TCONS_00001362-exon-sc0000010-1510915933:603499..604106TCONS_00001362-exon-sc0000010-1510915933:603499..604106Clytia hemisphaericaexon
TCONS_00001362-exon-sc0000010-1575043694:603499..604106TCONS_00001362-exon-sc0000010-1575043694:603499..604106Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000010supercontigsc0000010:598342..604106 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0.519889 0 0 0 0 0 0 0.426568 0 0 0 0 0.389769 0.165316 1.40242 1.49628 4.05701 4.80438 2.32615 3.85778 5.60154 13.3118 0 0 26.1585 75.1849 0.0404662 0
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001362 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top