Error message

  • Notice: Undefined variable: cmd in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 96 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).

TCONS_00001265 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001265
Unique NameTCONS_00001265
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length4715

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001265 ID=TCONS_00001265|Name=TCONS_00001265|organism=Clytia hemisphaerica|type=transcript|length=4715bp
CTTTTGTTGACGAATCATACACGTAGACAATTGGTTTGACAAATATATAA
GCAAATAGGATAAAAACAGTTTCATGTCAAAGACGGAAGTGTAAGATGCC
TTCTAACAGAAACAGTAGTATACAAATCGAAGAAAGATCGAGTCGATGAT
GGAGGTAGAGCTGGTAGAGGAGATAGGTTTttatatcttaatttttttgc
aaatattcTTCCTTTACTTTTACCCAATGATGATATGGCTACACCCATGG
TGTAGAAAACGACGTGGCAAATGGTACCATTGGAGATTGTACTATTTTCG
TAAGTAGTATCAATTTCATGAAATACTTTTTGCCAAGAATATTTATTGTG
ATTTTAATTTAAAGTTAACAAATCAACTGTCAAGCCGGTCTTTAAGAAAA
TATCAACAGGATCTTTAACGTAAAGGGCAACAATGCAGACAGGTGCAACA
TCGGTAAGTAAACGTTGGAAAGTCGATCTCTCAAAATGACATCGGTTACT
TAGGTTGCTCGTTCATTGACAGTCttgaaaaagtcatcaatgttTATCGG
TAGGAATAATAATACACTATACACTACATTATAGTACCGTAATACAAACC
AAATCTTCTTTTAATATTTCAGTCTatgcatttggttggttgatattcgc
TTTACCATCGCACAACTTCAGCAAGACATATTATATGGTAGTTGGCTCGG
TCATTCATATAACCATTGTACCGTTCATTTTGGGTTGTCGTCGGTACAGA
AAGCGAAAAGAAGATTTGAATgcgaaaatgaaagaactagctGCTTTGAA
ACCACAAGTCATTACAATTTGTAAAGTCACTGAGCCTCGTTCTTCGTGCT
GCGCAAAACAACAAATCATTTGGAGAGAACAGAAAGAATTCGAGTACCGA
CATTGGATAGATCTAACTGACCAATATTCAGTCGAATTGGAACCACNGCT
GCGCAAAACAACAAATCATTTTGAGAGAACAGAAAGAATTCGAGTACCGA
CATTGGATAGATCTAACTGACCAATATTCAGTCGAACTGGAACCACAGAT
GAAAAACATGGTCGAAGgtgaattgaaaattgaaatagaaTTCGATGACG
GTGAAACGAGGGAATCTTATATTCAACATGTCCAAAATCTTCGAAATGAA
TTGCCACAATATTGCCAAAATGCTCACATTTCTACTAAACGTGTTTTCAA
AGTCGATGAAAGGGATATCGAATCTATCGAAAGATCGTTTTATGGAAGCC
ACATGCAACCATTATTCCTTTTAAAACTCGTTCATCCACAGATAGAATTT
TCTTTCAGAGTGGTGAATTGGTTTCTTCAAAAGTTTGGGTCGAAGAAATT
ATTGACTAAAGAAATTATCATCAAGAAGGTTATTTCTGACAGAACTATTG
AAGCTCTTTGAACATGATGATGTATTTACCGAAAGAAGGAAATCAAAAGT
TGATGATGGAATCCCATTCCATCAACTATTTTGAAGGATAAAGGAAACTG
CAACCTTAGCAACGCTCTATTGATCCTTTTTGTTACTCGTTTTTagatca
tttttttttattatctatTTTGAGCACTAGAAAAAATGATTTAAGCCCTC
TTGCATCCATATTAATGACTTATTTTCATAGACTTTCATAGACAAGCCAA
ATTGGTTTTTTTATCTAACTCGTCTGCGTTAGCTATCAAGAAATAAGAAA
TGCATCGATCCATCTTTTGTCTTTAaagaacatattttttttaatgaatg
aGCATGCGTGAAATGTATTTTGACATGCGGTTGCCATGGAAAGAATATAT
CGGGGATGTCACAAACAAGCATGGAAGCTGTCAGAAAACACGCcaggaga
aaaatgaagatagggaagatgaaaacgaaaaaaaagagaaaacatttttg
gtttgaaaatggaagaAAGAAGGTCTGAAAAATATGCACTGATATGTgcG
ATACTTCTAACTATAGTTGGTGGTTCATGGTCCTTGGCCAACAACACAAT
AAACTCACAACAAAACACTACAGTTACTGAGACAGTATGTTGGAACATCA
CTTGCAACAGCAGTGAGAAGTGTTCAACAACGATTACTCTCAACACTACA
ACATCCACCCTTCTTCAACTGGACAACCAAACATGCTTTCGAGCAGATTG
TATGGATTTGAAGTGCGCTCAACAATACCTCAAACAAACAGTGTCGCTAC
CGATGAAGGAAAGTTGTGTCGAAATGTCATGTCTCAACACGTCTTGTATC
GAAGATACCATCTCAAACACCAGTTGTTTTCCAAAACAAACATCGACCTC
TGCACCAACGACTACAACNGACATCAGTTGTTTTCCAAAACCAACCTCAA
CCTCTGCACCAACGACTacaaccacaacaacaaaaTCCATGCAACAACTA
CGCCAAGAAGAGTGCGACCAATACAAATACTGGCTATTCAAAAACAAATG
TTCGTCGCGCTTCAGTTTGTGTGCAAAGGACGTCTTTCTCAATATGAGTC
AACATATTGAATGCTTAGAAGAGAAGGGAACTCAACATTACAAATACCCT
GCTGCGCCAATGTTGTTAATCTACCATTTGATCAAATATACCAAAGTCTT
TATGAAGGATGAAGTGCTGAAAATGATCAAGAAAACGCCTTTCCCGATTG
AGGTCTTCAAAAAGTTAGTTTGGTATGGCGAAGAATCGTTCCGCATGTCT
GATATTGTATTACCCGGTTATCATAAGAACCCGTTCAAACGATCGCGGCG
ACGTTGGAACGGGATTAACGATACGCTAACCGTGCCTTACGGGAACATCC
TACGTGGCGATTTCATCTATAACTTTGCCATGTTTGATCAAGTGGTCGTg
gcaaaacaagaaaaagagaaatatcGATTGAAAGACAACTGGCCTGACCA
GCATCCAATCTCAAATGGAGAATACATCAGTTTCAGAAGCGAAACCGGAT
GGAAGCACTATACTAATCACGTGATCAACTCAATAGTGGTCACTTTCGAT
ATCGAGCCAGCGATGGCTGAGCTTCCCACGTACAACACCATCGCGTTTAC
ACACAAGGATCGGAAAATGGTCAATCCAATCTGCGTATATTGGCAACCGT
TGAATGCTGGCAAAGAAGGAGCGGACCCAGAAGCAGGATATTGGACCAAT
TACCATATGAAGATattgaaaaccaacaaatcgATGACCGTTTGCAAAGC
GTATACTTTTGGTTCGTTCGCTGTACTGATGGAACCATACGTACCAAAAA
ATAACAGCCAACCTCTGGATGTCACCGAGATTCTCTTCCTAGCGTTTATC
TCGTTCTCCGCCCTCCTTCAACTGGTGTATTTGGCGGGGATGTTCTCCTT
GAAGTGCCATAAGAATAGCGCTAACAGATTGTATATTTACGCAAACCTCA
GTCTGTTCATGATGCAAGTATTGATCGTTTTCTCCTTCCGCCATCGTGAC
GATTGGGAAAAGTGTGCTATATATACAGGTTGGATACAGTTCTTTTTCAT
CAACATATTGAGTTGGCTAATGATGGAGAGTGTACATCGCTTGTCGAATC
TCCTTCATTTCTTCCACAAAGACACCAACAGAGATTTCTTATATCACATC
GTCGGCCTGGGTATCCCCCTTTCCAATATGATTGCAATGCAAGGTTTCCC
GTATGACGAGTACAGCTCACTCCGCATCTGTTGGGTGTACGCCAACGACT
TACGGCTTTGGTATTTCATCAACCCTATCACAGCCATCATTTGTGCCAGC
TTCTTAATCAAGTTCATCACCTTCAAGAAATATCAAGGCCAGGATAAGTT
TCTAGAGAATGATTTCAACTACCAGCAAGCGCAGTTGAGTGTGTTTGCCA
CCGGAGCCATCTTACCCACCCTCCTGATCGGCTGGACCTTGATGAGCGTG
TCAGTGCGCACTGAAGCAAAATTGCAGAATTTTCTTCTCATCGCAGCATC
TATCGCTCAAGTATGTCTTGGATTGCAAGTGCTTTACTTTTATTTCTACC
GCAACCATTGGGTGGTGGAAGCGATGACCGAGGAGAAACGTATCAAGGAG
AAAAAGAAGTTGACCACCTTATCTTTCTTGAAAGGACTTCCCATTCGTAT
ACGTTACAAGGACAATCCTTATGACGCAATGGAGGAGAAAAGTGAGGACT
CGTACGAAATGAGATACACTTCATCTTCATCTCTTGGCGATGAAATCATG
TTAGACGAAAGTGTTTATTGACTCCTTCATCTCATTCATTTAACCTTTTA
ATGTAATTTTGTTAGACAGAGACGAGTAATAGCAGTCTAAAGCAGACCTT
CTGTATGAAACACTGTTGAGAAACACTGATGAACTTGCACTGAGTAAAGA
ACTGCATCTTATATACCGTTTTTAACACTTTGCGTAAGATACATATTAGA
AAGTGCATGTTTATGGGTGCGGAGAAAGCAAATTACTACGAAAATTGAAA
TCGAACGAGAAAAAACGTTGCGAGTTGAatgaattatttcaaaatataat
ataaatcaTATAAATCTTTTAGTGGGTTTTTCTTCCATGTTATAATTTGT
TTATTATTCAGTAGTGAGTAGCTAACTTTTGATGTACATAGATGTCATGA
ATAAATCATTCCACTAATATATTCAAATGGTATGAATCAAAAGGCTAAGG
TTAGttcattctatttttatctGGGTTGAATCCGAACATTGAAAGGTTAC
CAGGTGACAATGAAA
Run BLAST on NCBI

transcript from alignment at sc0000007:1402001..1407124-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001265 ID=TCONS_00001265|Name=TCONS_00001265|organism=Clytia hemisphaerica|type=transcript|length=5124bp|location=Sequence derived from alignment at sc0000007:1402001..1407124- (Clytia hemisphaerica)
CTTTTGTTGACGAATCATACACGTAGACAATTGGTTTGACAAATATATAA GCAAATAGGATAAAAACAGTTTCATGTCAAAGACGGAAGTGTAAGATGCC TTCTAACAGAAACAGTAGTATACAAATCGAAGAAAGATCGAGTCGATGAT GGAGGTAGAGCTGGTAGAGGAGATAGGTTTTTATATCTTAATTTTTTTGC AAATATTCTTCCTTTACTTTTACCCAATGATGATATGGCTACACCCATGG TGTAGAAAACGACGTGGCAAATGGTACCATTGGAGATTGTACTATTTTCG TAAGTAGTATCAATTTCATGAAATACTTTTTGCCAAGAATATTTATTGTG ATTTTAATTTAAAGTTAACAAATCAACTGTCAAGCCGGTCTTTAAGAAAA TATCAACAGGATCTTTAACGTAAAGGGCAACAATGCAGACAGGTGCAACA TCGGTAAGTAAACGTTGGAAAGTCGATCTCTCAAAATGACATCGGTTACT TAGGTTGCTCGTTCATTGACAGTCTTGAAAAAGTCATCAATGTTTATCGG TAGGAATAATAATACACTATACACTACATTATAGTACCGTAATACAAACC AAATCTTCTTTTAATATTTCAGTCTATGCATTTGGTTGGTTGATATTCGC TTTACCATCGCACAACTTCAGCAAGACATATTATATGGTAGTTGGCTCGG TCATTCATATAACCATTGTACCGTTCATTTTGGGTTGTCGTCGGTACAGA AAGCGAAAAGAAGATTTGAATGCGAAAATGAAAGAACTAGCTGCTTTGAA ACCACAAGTCATTACAATTTGTAAAGTCACTGAGCCTCGTTCTTCGTGCT GCGCAAAACAACAAATCATTTGGAGAGAACAGAAAGAATTCGAGTACCGA CATTGGATAGATCTAACTGACCAATATTCAGTCGAATTGGAACCACNGCT GCGCAAAACAACAAATCATTTTGAGAGAACAGAAAGAATTCGAGTACCGA CATTGGATAGATCTAACTGACCAATATTCAGTCGAACTGGAACCACAGAT GAAAAACATGGTCGAAGGTGAATTGAAAATTGAAATAGAATTCGATGACG GTGAAACGAGGGAATCTTATATTCAACATGTCCAAAATCTTCGAAATGAA TTGCCACAATATTGCCAAAATGCTCACATTTCTACTAAACGTGTTTTCAA AGTCGATGAAAGGGATATCGAATCTATCGAAAGATCGTTTTATGGAAGCC ACATGCAACCATTATTCCTTTTAAAACTCGTTCATCCACAGATAGAATTT TCTTTCAGAGTGGTGAATTGGTTTCTTCAAAAGTTTGGGTCGAAGAAATT ATTGACTAAAGAAATTATCATCAAGAAGGTTATTTCTGACAGAACTATTG AAGCTCTTTGAACATGATGTATTTACCGAAAGAAGGTAACCAAAAGTTGA TGATGGAATCCNTGAAGCTCTTTGAACATGATGATGTATTTACCGAAAGA AGGAAATCAAAAGTTGATGATGGAATCCCATTCCATCAACTATTTTGAAG GATAAAGGAAACTGCAACCTTAGCAACGCTCTATTGATCCTTTTTGTTAC TCGTTTTTAGATCATTTTTTTTTATTATCTATTTTGAGCACTAGAAAAAA TGATTTAAGCCCTCTTGCATCCATATTAATGACTTATTTTCATAGACTTT CATAGACAAGCCAAATTGGTTTTTTTATCTAACTCGTCTGCGTTAGCTAT CAAGAAATAAGAAATGCATCGATCCATCTTTTGTCTTTAAAGAACATATT TTTTTTAATGAATGAGCATGCGTGAAATGTATTTTGACATGCGGTTGCCA TGGAAAGAATATATCGGGGATGTCACAAACAAGCATGGAAGCTGTCAGAA AACACGCCAGGAGAAAAATGAAGATAGGGAAGATGAAAACGAAAAAAAAG AGAAAACATTTTTGGTTTGAAAATGGAAGAAAGAAGGTCTGAAAAATATG CACTGATATGTGTAAGTCTGTTTTTTGTTATTGACGGTTACTAATATTTG CGGTGCGGTAATTTTAGACTTGAATTGGATTCAATTTCAGTTGTTGTTTA AATTATCTAAGCTCAGCGGGAGCTCACTTGCGTAATTTAGAGCCCAATTC TGTAAAACTTCGAAATTTTAGTCTCAGTTAATTGTTTGTATCTTCTAAAA CAAAATCTCCGATTCAGATACGTTTCAGATCAACTACTTTTTAAGTACAA AATTTGGATCTACTTAGTNGATACGTTTCAGATCAACTACCTTTTAGGTA CAAAATTTGGATCTACTTAGTTGCAAAATTCTAAGCATATTCATTTTTAA TTTTAGGCGATACTTCTAACTATAGTTGGTGGTTCATGGTCCTTGGCCAA CAACACAATAAACTCACAACAAAACACTACAGTTACTGAGACAGTATGTT GGAACATCACTTGCAACAGCAGTGAGAAGTGTTCAACAACGATTACTCTC AACACTACAACATCCACCCTTCTTCAACTGGACAACCAAACATGCTTTCG AGCAGATTGTATGGATTTGAAGTGCGCTCAACAATACCTCAAACAAACAG TGTCGCTACCGATGAAGGAAAGTTGTGTCGAAATGTCATGTCTCAACACG TCTTGTATCGAAGATACCATCTCAAACACCAGTTGTTTTCCAAAACAAAC ATCGACCTCTGCACCAACGACTACAACNGACATCAGTTGTTTTCCAAAAC CAACCTCAACCTCTGCACCAACGACTACAACCACAACAACAAAATCCATG CAACAACTACGCCAAGAAGAGTGCGACCAATACAAATACTGGCTATTCAA AAACAAATGTTCGTCGCGCTTCAGTTTGTGTGCAAAGGACGTCTTTCTCA ATATGAGTCAACATATTGAATGCTTAGAAGAGAAGGGAACTCAACATTAC AAATACCCTGCTGCGCCAATGTTGTTAATCTACCATTTGATCAAATATAC CAAAGTCTTTATGAAGGATGAAGTGCTGAAAATGATCAAGAAAACGCCTT TCCCGATTGAGGTCTTCAAAAAGTTAGTTTGGTATGGCGAAGAATCGTTC CGCATGTCTGATATTGTATTACCCGGTTATCATAAGAACCCGTTCAAACG ATCGCGGCGACGTTGGAACGGGATTAACGATACGCTAACCGTGCCTTACG GGAACATCCTACGTGGCGATTTCATCTATAACTTTGCCATGTTTGATCAA GTGGTCGTGGCAAAACAAGAAAAAGAGAAATATCGATTGAAAGACAACTG GCCTGACCAGCATCCAATCTCAAATGGAGAATACATCAGTTTCAGAAGCG AAACCGGATGGAAGCACTATACTAATCACGTGATCAACTCAATAGTGGTC ACTTTCGATATCGAGCCAGCGATGGCTGAGCTTCCCACGTACAACACCAT CGCGTTTACACACAAGGATCGGAAAATGGTCAATCCAATCTGCGTATATT GGCAACCGTTGAATGCTGGCAAAGAAGGAGCGGACCCAGAAGCAGGATAT TGGACCAATTACCATATGAAGATATTGAAAACCAACAAATCGATGACCGT TTGCAAAGCGTATACTTTTGGTTCGTTCGCTGTACTGATGGAACCATACG TACCAAAAAATAACAGCCAACCTCTGGATGTCACCGAGATTCTCTTCCTA GCGTTTATCTCGTTCTCCGCCCTCCTTCAACTGGTGTATTTGGCGGGGAT GTTCTCCTTGAAGTGCCATAAGAATAGCGCTAACAGATTGTATATTTACG CAAACCTCAGTCTGTTCATGATGCAAGTATTGATCGTTTTCTCCTTCCGC CATCGTGACGATTGGGAAAAGTGTGCTATATATACAGGTTGGATACAGTT CTTTTTCATCAACATATTGAGTTGGCTAATGATGGAGAGTGTACATCGCT TGTCGAATCTCCTTCATTTCTTCCACAAAGACACCAACAGAGATTTCTTA TATCACATCGTCGGCCTGGGTATCCCCCTTTCCAATATGATTGCAATGCA AGGTTTCCCGTATGACGAGTACAGCTCACTCCGCATCTGTTGGGTGTACG CCAACGACTTACGGCTTTGGTATTTCATCAACCCTATCACAGCCATCATT TGTGCCAGCTTCTTAATCAAGTTCATCACCTTCAAGAAATATCAAGGCCA GGATAAGTTTCTAGAGAATGATTTCAACTACCAGCAAGCGCAGTTGAGTG TGTTTGCCACCGGAGCCATCTTACCCACCCTCCTGATCGGCTGGACCTTG ATGAGCGTGTCAGTGCGCACTGAAGCAAAATTGCAGAATTTTCTTCTCAT CGCAGCATCTATCGCTCAAGTATGTCTTGGATTGCAAGTGCTTTACTTTT ATTTCTACCGCAACCATTGGGTGGTGGAAGCGATGACCGAGGAGAAACGT ATCAAGGAGAAAAAGAAGTTGACCACCTTATCTTTCTTGAAAGGACTTCC CATTCGTATACGTTACAAGGACAATCCTTATGACGCAATGGAGGAGAAAA GTGAGGACTCGTACGAAATGAGATACACTTCATCTTCATCTCTTGGCGAT GAAATCATGTTAGACGAAAGTGTTTATTGACTCCTTCATCTCATTCATTT AACCTTTTAATGTAATTTTGTTAGACAGAGACGAGTAATAGCAGTCTAAA GCAGACCTTCTGTATGAAACACTGTTGAGAAACACTGATGAACTTGCACT GAGTAAAGAACTGCATCTTATATACCGTTTTTAACACTTTGCGTAAGATA CATATTAGAAAGTGCATGTTTATGGGTGCGGAGAAAGCAAATTACTACGA AAATTGAAATCGAACGAGAAAAAACGTTGCGAGTTGAATGAATTATTTCA AAATATAATATAAATCATATAAATCTTTTAGTGGGTTTTTCTTCCATGTT ATAATTTGTTTATTATTCAGTAGTGAGTAGCTAACTTTTGATGTACATAG ATGTCATGAATAAATCATTCCACTAATATATTCAAATGGTATGAATCAAA AGGCTAAGGTTAGTTCATTCTATTTTTATCTGGGTTGAATCCGAACATTG AAAGGTTACCAGGTGACAATGAAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000671XLOC_000671Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001265-exon-sc0000007-1575043694:1405712..1407124TCONS_00001265-exon-sc0000007-1575043694:1405712..1407124Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1575043694:1405114..1405647TCONS_00001265-exon-sc0000007-1575043694:1405114..1405647Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1575043694:1402001..1404768TCONS_00001265-exon-sc0000007-1575043694:1402001..1404768Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1510915933:1405712..1407124TCONS_00001265-exon-sc0000007-1510915933:1405712..1407124Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1510915933:1405114..1405647TCONS_00001265-exon-sc0000007-1510915933:1405114..1405647Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1510915933:1402001..1404768TCONS_00001265-exon-sc0000007-1510915933:1402001..1404768Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1491911889:1405712..1407124TCONS_00001265-exon-sc0000007-1491911889:1405712..1407124Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1491911889:1405114..1405647TCONS_00001265-exon-sc0000007-1491911889:1405114..1405647Clytia hemisphaericaexon
TCONS_00001265-exon-sc0000007-1491911889:1402001..1404768TCONS_00001265-exon-sc0000007-1491911889:1402001..1404768Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:1402001..1407124 -
Expression
No biomaterial libraries express this feature.
Blast
BLAST of TCONS_00001265 vs. Swiss-Prot (Human)
Match: AGRL3 (Adhesion G protein-coupled receptor L3 OS=Homo sapiens GN=ADGRL3 PE=1 SV=2)

HSP 1 Score: 92.0485 bits (227), Expect = 2.135e-18
Identity = 106/460 (23.04%), Postives = 179/460 (38.91%), Query Frame = 1
Query: 2962 TNH--VINSIVVTFDIEPAMAEL-----PTYNTIAFTHKDRKMVNPICVYWQPLNAGKEGADPEAGYWTNYHMKILKTNKSMTVCKAYTFGSFAVLMEPYVPKNNSQPLDVTEXXXXXXXXXXXXXQLVYLAGMFSLKC-----------HKNSANRLYIYANL--SLFMMQVLIVFSFRHRDDWEKCAIYTGWIQFFFINILSWLMMESVHRLSNLLHFFHKDTNRDFLYHIVGLGIPLSNMIAMQGFPYDEYSSLRICWVYANDLRLWYFINPITAIICASFLIKFITFKKYQGQDKFLENDFNYQQAQLSVFATGAILPTLLIGWT----LMSVSVRTEAKLQNFLLIAASIAQVCLGLQVLYFYFY----------------RNHWVVEAMTEEK--RIKEKKKLTTLSFLKGLPIRIRYKDNPYDAMEEKSEDSY-EMRYTSSSSLGDEIMLDES 4212
            TNH  ++NS V+T  I    +       P   T+    +  +  NP C +W              GYW+    ++L TNK+ T C      +FAVLM     K++    D+             L  + ++  + SL C               ++R  I+ NL  SLF+ ++L +      D    CA++   + FFF+   +W+ +E V     L+  F  + +R   +++VG G+P   +       Y  Y + ++CW+  +   +W FI P T II  + +   I   K       L+ +       +  +  GAI    L+G T    LM ++  T        +I A +  +   LQ ++ + +                R H      TE      K     T   +  G   RIR   N  D + ++SE S+      SS+SL  E +L+ +
Sbjct:  758 TNHSVIVNSPVITAAINKEFSNKVYLADPVVFTVKHIKQSEENFNPNCSFW------SYSKRTMTGYWSTQGCRLLTTNKTHTTCSCNHLTNFAVLMAHVEVKHSDAVHDL------------LLDVITWVGILLSLVCLLICIFTFCFFRGLQSDRNTIHKNLCISLFVAELLFLIGINRTDQPIACAVFAALLHFFFLAAFTWMFLEGVQLYIMLVEVFESEHSRRKYFYLVGYGMPALIVAVSAAVDYRSYGTDKVCWLRLDTYFIWSFIGPATLIIMLNVIFLGIALYKMFHHTAILKPESGCLD-NIKSWVIGAIALLCLLGLTWAFGLMYINEST--------VIMAYLFTIFNSLQGMFIFIFHCVLQKKVRKEYGKCLRTHCCSGKSTESSIGSGKTSGSRTPGRYSTGSQSRIRRMWN--DTVRKQSESSFITGDINSSASLNREGLLNNA 1188          
The following BLAST results are available for this feature:
BLAST of TCONS_00001265 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
AGRL32.135e-1823.04Adhesion G protein-coupled receptor L3 OS=Homo sap... [more]
back to top