TCONS_00000526 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000526
Unique NameTCONS_00000526
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length3804

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000526 ID=TCONS_00000526|Name=TCONS_00000526|organism=Clytia hemisphaerica|type=transcript|length=3804bp
ATGGATCATATTTGTGAGCAGACACCAACAAGCAACTCTGATATTTGTCC
AACTCTTGGAAGACCAAAAAGTTCTGAAAAGGTTCATTTGCTaaacaaaa
agaagattttggaTTCTACCCGAAGCATCTATGAAAAAGAAGCGAAAGGC
GAAGCAAGGAACATCCAATACGACTCTTTAGATGGTTATTCGTTCACTTA
TCCTGCTTATCAAGATCCTTCACCAATGGAATGCACATGCGCACAAAGGG
ATCCCAGATTCAGTTCGCGATTGGCAGAAACTTTAGCAGGCAACGAAGGC
AGACATTTTGTGATTGTGCTCGATTATTCCGAGAAAATTCAAAACACAAT
TGACATCATGAGGAAAGTTGCAACGACATTGTTTAAACTTTTTACATCCA
AAGATATGATTTCAGTGAAATTTTATCACGAGGATAATTTGGTACCAGCG
GACAAAACAGCagattgtttgaaaatttcatcacaaGCTACTCCTTATAT
CAAAGATAAAATTCTCGGAGAGATTGAGACTAAACAGCCAAAAGGAGACG
CAGCAAGCTATTCCAAGGTTTTCCGCGAATCTTTTACTGCTCTCAAGAAT
GATAACAGCAATCAAACTGAGAAACATTTCATCTTTGTCACAAGTGGTCA
TTACATTGATAATTGGTCAGAGATTGACCAAGTCTtcaaagaaaggagaa
aaacgAATTCAGAATGCAATGATATGTACTTTTCGTTGTTATTAATAAAT
GatgGCAAACTACCAAAAGCTAATTTCGTCAAAAATAAGAACCTCAAAGA
GGGTTGTAATgacaattttattgattttgagCTTAGTGGAGACAACAATC
ATTTTACAATCAATTCCAAGATATCTGAAATTCTACCCTCTGGAAGAAAT
ATCGACGATAAAGTTTATTACATCATGCCTATATCTGATCGATTTGGTAG
AGGCACAACGATTGATGCATGTAAAGCAGTGGTGGATAAAAGTTCATCTT
CACAAAATCCAATGAAAGGAGTTGTTTGTCTTTCTTTCTTGACCAATGAA
TTTATTCGCGAAGAATGGAGTCAAACGGAAAATTCTTATTGGTTCCTTAT
AAAGAGAAACGGCCAAACATTCATACACCCGAAATTCGGACAACCACTTG
GATCAGATGAACTTTCTCGGACAGTTAGTATTTTACAAACCGAATCTTCA
CAAAGTTTCAAAGATGAAGTTTACAATAATATGATAAGCGGCGTTCCCGG
GTCAAAGACATTATCACACGTAATGAAACCAATATCTCGAGGGCCTTTTG
GAGCAACctcacaaaacaaaacattgacTTATACTTGGAAAGCTGTTCCA
AAGTCTGACTTCATTATGACCATTGTGACGTCATCTGATTACGAAAAGTC
CGAACTCAAAATCACCAATCAAGGAGGGAAAGAAAATTACCATCGCATTG
ACTTGATTCCAGATAATTACGCGAATGATTTGTGCAAATACAGTAGTGAA
CATGTTGCTACAAAAGATCTTTCGGTTATCAAATTCCCAGCAGATGCTTT
TCAACGACCAAGTTTTTACTTCAAACTTGAAACTAATGAAACTGTAAAAG
AATTGAATGATTTGTTTACACCTGGGAACACGGCAACCCCTCCTGATGAA
TTGTTCAAGGACATGGATGTGTTCAACCATCTTCGTCAGTCAGTGCAAGC
TACACATTTGATGGAGGGATATTGGAAAAATGACACATCTGAAGCTGCAA
AGAACACGTTAACAAGATACATTGGTATGCATAATGGCTTCTTTCGAACG
TTTCCTGGACATTTGATGAATCCTTCATACGATCCAAGAGCTCGACCATG
GTATCGATTGATGATTGCACAAAAAGGAATAACTTTAACAACACCCTATC
CAGATGCCTTTACCGGTGAAATTGTCATGACGCTAGGGAAAGTTCTACTG
AAAGGAAAGAAGTCAGTAGAAAAAGCAGGGAACATTGCTATGGATTTCAA
ACCACTCTACTTCAAAGAGTTACTAGAAAGATCGATCAAAGAGTGTGCAT
CTGGAGCATGTGTTGTGATTGATCGAAACGGCTTCGTAGTTTATCAATCG
AGTTTTATGGAAGAGAATGAAAATTCAACCCTCGAAAATCAACACATCGT
GAAGATGcatGGTAGACTCGCAAAGACGATGATTGAGAATGGagttatga
taaaaaattattgtttgGAATTCCGAAACAATGTAACCGTAAAAGAATGG
TTTTACTCTCTTGACCACGTGATAGAAGCGAAATCGTATAGCAAGGGGTG
TTTGAAGGATTATCATGTTGTGCCGATTATCGATTCCAATCTTTTATTGT
TGTATATTAATGATCGATGTGATGTTAAAGAGAAATGTACTTGCAGAGAA
CCGATAAACGGGgaaagatTTGGGTATTGTTCGAACGATATCAGCGAAAC
AAATTGTGAATGTCCTTGCATACAACCCGTTACTTGTCTCAGTGATCTTC
GAATTACCCCAGGCAGACTTGAATGCAACCCAGAGGACAAACGAAAAACA
GATTTCTCAGAAAAATGGTTCAAAGGAAACATTTCAGAGCTTACTCTCTG
TTTTGACCCTGAATGCAAGAAACGCGACACATGGGATAATTGTGAAAGTT
TCAAACCTGCTTGCAACTGGTGTTTCAAATTCCCAAATGGAACCCATGTT
GCCGACGAGAAAAAGCATTGTGATTATTCTGACGAAGAATGTTTTCCGAC
GCCATCACCACCCATCATAACGCCTGCACCACCCACAACACCTGACTCGC
AAGAAACTGAGGACCTATCAGATGGTGCTATTGCTGTGATTATACTATTT
AGTATAATATTTGTATGCTCCATACTGGGTGGTATCTACTGGTGGTTCAA
TAAAAAAGCTAAACGAAGACAACGTAATAACAATAACAACGGGAATAATT
CTAACACAACACTTACTCCTCGAGCCAACAGTGGTTTTGATGATGACCAA
TATCAACCAGGATATCAACCATCAGGCCACGCACCAAACGATCGACTAGG
ATCAGTACCATCACCGACTGATACCAAAGATGCTGCAGTAGAGATAACAA
TGCCAGCAGTGTACGAGGAGAGACCTGCAGATGAAAATGGTTCAGTTAGT
ACCACGGCTTAAACCATCGCATAGTatgtaaaaattaatttttctgagta
ctattcaataaacaAAGACTTAAAAGATTTCATTACATTAAAAGGACATT
TCacatcagacacatatttcatatcaggacagtgtctccctattgttttC
TTATACTGATTTAagcaaaaagatgtttttcttttccttttttctgacca
atcttgctccatatCCGTGTCAATCCGATGTGATAAAGCTTGTGAGTTGa
agttgatgagtaagcaaacgatatcactcttatttgaaaacaaaagactt
tttgaaatctgaataagTTTACTACGAGTATTATTAGCAAAACGTTTTGC
AGTTAGAAGTGtccaaaaatataattttatggTGTTGCAAAACCGTAATC
TGGAAACATTTTGGGATCCCTCTCCCTCCCTAGGCCCACTTAATGCAAGT
CAAAGTGACTCATAAAAAAGAGCTTTTttgaagaacaaattagtgggTTG
CTTTGAAGGATCTTATATTACACGAAGCTGACATTTTGTACTTTCAAGAT
CCTGCagattctaatttattttttctcgACACATTGTAAATATCTAGCTA
TTTTATTGTATACACACCTTTCATTGTATATTTGGGATAgaatttttcaa
agtc
Run BLAST on NCBI

transcript from alignment at sc0000002:268592..357435-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000526 ID=TCONS_00000526|Name=TCONS_00000526|organism=Clytia hemisphaerica|type=transcript|length=88844bp|location=Sequence derived from alignment at sc0000002:268592..357435- (Clytia hemisphaerica)
ATGGATCATATTTGTGAGCAGACACCAACAAGCAACTCTGATATTTGTCC AACTCTTGGAAGACCAAAAAGTTCTGAAAAGGTTCATTTGCTAAACAAAA AGAAGATTTTGGATTCTACCCGAAGCATCTATGAAAAAGAAGCGAAAGGC GAAGCAAGGAACATCCAATACGACTCTTTAGATGGTTATTCGTTCACTTA TCCTGCTTATCAAGATCCTTCACCAATGGAATGCACATGCGCACAAAGGG ATCCCAGATTCAGGTTTGATAATCTTTTTTTTCAACTCAATTTTAAGCCA TACAACGTGTTTTTGTAATGGTATAGTGAAGTCTCTATAACTCAAACACT CGCCAGAGAACACAAGTTTGTTCAAGCGAAGTGGTGCAGTGGTAGAGCAT CCTGCTACGGTACGCAAAGTTGTGGGTTCAACCTCTAGCGGGGTCATACC AAAGATTTCCAAAATGGTACTTGATGTTTCTCTGCTTGATGCTCAGTAAT TAAGAGAAGGAGCGAGGGTAAGTGGAGTAACCCAGGGAGAAAGAGTGGCA CCCTCCCCTACCTTCGGGTAGATAGCTATCGAAAGAGGAGCCTTTGGATC GCCTACGACTGCGATCGCAGCCTTACTTTCTTGTTCGAGTTAAAGAGACA TTTGAATTATAGAGGTTCGATTTATTATGAAAACTCAACTATAGTAAAAA TAAAGGCTCAGATTTCGAAAAACACGGATTTAAAGACGCTTTAAAAACTC TTAGATGAATAAAGAAGATCTTTGGGATATCTTCGAAGTCGCTCAGACAA AGCTCGGTAAAAGAATCGGTACATTTTTTTTTCAAATCATTTTCTTCATA CAGTTCGCGATTGGCAGAAACTTTAGCAGGTAACAAAGGTAGACATTTTT TGATTGTTCTCGATTACTCAGAGAAAATTCAAAACACCATTGCCATCATG AGGAAAGTTGCAACGACATTGCTTAAACTGGTTACTTCCAAAGATATGGT ATGATACATTATTTATTTAATGTCAGGGATTTTTCAATTTTTCAAAGTAC CTCATTACACGAATACTAGGTAAGTATTGAAATTTGGACGATCTGAAATA AACTTTTTCAAGGAAACATCGGCTGGTTTTAATCAAGGGGGTTTTTATTA ATACGAAATTTTTCAATTCGTGTTAATAAAATGACTAGTTATATTCGTGT AATAAGGTAGCTTTGAATACACCTTTTTTATAAGTTTTTAGAGCCTGGAA ATATTTTTGAGATGTTCTTATTTACAGCATTTTGAAAGTATTTTACTGTA GTTTCTAAGCTAAATCTTTGAAATGTTCTTAAAATGTTCTGAAATCTTGG ATTTTTTTGCATCGAAGCATCATTTTCTTTACATACTTTTTTCTTAAAAA AAAACATGTATTATGGTTCAGGATTTAATCTATGTATCTTGTATACTCCA AATTTGGAGCTTTTCCTCATTCCTGTCAGTCCGAAAGTTGAAAGCTGAAA TAATTTATTAGGATTCTTTTCCGTTTTTCCAGAACACTGAACATTTGAGT ATGGTAATACTGGATTTTAAGATTGAACCTAAAATTTTTCATCCTTATAG ATTTCAGTGAAATTTTATCATGAGGATAATTTGGTACCAGGGGACAATAA AGCAGATTGTTTGAAAATTTCATCAAAAGCTACTCCTTATCTTAAAGATA AAATTCTCAAAGAAATTGAAACTAAACAACCAAAAGGTAAGGTTGACTCA TGGGTGGATATTGGGCGGTGGATATGACATTGTTGGTTGTAAAGATGGGA AATCTTTGAAGTCTGTGAAATCTATTCGCATTTTTGCGGAAGGTCTTTTC ACCAAAATAATAACTTGGGAACCGTTTGTTTGTTAGATAAAACTCAAGAA AAGACTAACTAACTACATTTTTCAAATTGATTCTGCATTCAATTAATCCA TGTTACTCTGGAAAGTTATCATTTTCTTTTCCTATAGGAGATGCAGCAAG CTATTCCAAGATTTTCCGCGAATCTTTTACTGCTCTCAAGAATGAACACA GCAATCAAACTGGTAAAAGAAGCTAATACAATCAAGAAATTAATACTTTC CTTCGAAACAATAATGCTTTAGTGAAAGTGACTTTTCTTCTTGCCACAAA AAAATAATTTTTGATGAACAAAAACTTTGCTCAAACTGTCCCGTGTTGCA ACAAGATGCATTTGTATTGAAGTTTTTATAAGATGCTCACATAATTGGTT ATTCAAAACAATAGAGATGACGCGTTCTTTAAAAAAATATAATAAAAGTT TTGGTTTGAATAGTTAACGACCAATCCAATGACAAAAATTCTTGTAAAAT GTTCATCTTGACCCACAAGACGACTTACAATCAACGTAAAAATTATATCG ATAGTCTTCAGTACTTCCACTTTGTACCATTAAATATTTCGATTCGGAAT GTTTAGTAGCTTCCAGGCTTTATTATCAGCCCTTTCGGAACATCTTTGAG CTTTTGGATCCGCAGATCCAACCCAATTTCTTAACTGTCATATTAAAATT CAGAGTTAAAACTCTACTCCGTCACCCAAAAACTAACAGACTTTATAAAA CCCTTCCAGTAGCGTAGCCAAGAGGGGCGCAAAACTTGTGTAGGAGAGCA GATTTTTATGACACTGCAATTATCTATTCATAACATTAAAAGATAATTAT AATGGAATAAAAATCTGCTCTCCTACAAAAACTTTGCGCCCCTCTTGGCT AAACTACTGCCCTTCTGATGTGATATTCTACCTCGCCGTCCTTGTTCCTG TAAAGCTTTTCTTATCATATCCATAGAGAAACATTTCATCTTTGTCACAA GCGGTTATTACATTGACAGTTGGTCAGAAGTTCAAACAGTTTTCGAAGAA GGGAGAGAGGATTTCGGATGCGATTTATCCTTTTCGCTGTTATTACTCTA TAAAGGTAAATTTTATTGTGAAGTCATTAGAAGCTTTTTTTTGAGCCAAC TAAACGAGCTTCGTTAGAGTTCTTACTGAGAAAAGCACTAATGATGCATC CATTACATGCTGAGTCATGGTCAGACATGTAGAAAATATGTTTTCGACCG TAGCCGAGGGAGCTTCGCAGGCTAACTTTTCTTTAACACCCACTGGGAAC CCTTCCCACTGGAAGAATTGGCAAAAATATCGTTCCTGCTGGAAAATTTT ACTCTAATTTTTGTCCCCGATGAAAATAATCAGATCAGCCAATCTTCACT GCAAATTATTTTTTCCATCCCGATTGAATTTTCTTGCTCAAAAACAATGG AATTCAAATCCCCAGTCATGAACAAAATAGGAATATCAATCCCCATTGAG TTTTGGTCCGTTATTTTTACCCCCACTGGCTGAAAAAAATCTCACCGGGT CTTTGAGAAGGGGGTGTTCTTTAGCTATCTATCTGAAGGAAGGGGAGGGT GCTACTCTTTTTTCTGGGTTTCTCAATATACACTTGACTCGTTTCATTAG TAGTTGCTTAGTTTCTGATCATCATGACATCCAAGTATTGGGAGGCTCAA CCTTTTATTTTACGGACGCTGAAGAAAAATAGAAGAATCTTAATTATAAT CAGTTAAACCAAGGAATTTTTTTTTGTAAGAACATTAGGCTTCGACGACC AAGATGTTAAGAACAAGTTAAGAACATTTTTAGGCTTGAAACTCAAAAAG TTAAGAACATCTCAAGGCTTAAAAAATGGATGTTCTTATAAAAAAAAAAC ATCCTGACCAAGGAATTTTAAGGAAAAATTTTATAATTATTAGATGTAGT CATGCACTTGAATTATTTTTCCCTTTTGATAACTTTTGACAATGATTTCA GATGGCGATTGGGGTACAACAACGTATAACAATAACAAGAACCTTAAAGG TGTTGGATGCAATGTTAAGGTAAGATACATTTGTTTGGTCATTACAGATG AATGAGTGGTACACGTATGTAGCAAAGATTCATATGATGAAGCCTCGTGC ACTTTTATATCCATACTGGGGGGTGGACGAACATTTCCAGGGGGTAACCC GAGGGGTATTTTCAGGGGGGAGTCTAAAGGAGTATTTTTTCATCTTTCCA GAGCGTAAAAGACTATTCTAAAATTTCCAGGGGGTAAAAGACTGGTTTTA GTTTATTGAATTATGAAAAGAATTTAGTAAATCTTGCCATTTTCCAGGGG GTATCTACACATTTCCAAAAATATTTTTTAGTAAGAAAACCAAACGAAGG TCCAAGACCAATATCTTTGGTCGATCACAGATGAAGGACTTCCTGTGATT TTGGAGAAATTCGTTGACAAACAAAGTTCCGAAGGGGCAGCTTACAGTGG GGCTTTTTTCGATTGTGAGGGTACCAAACAACTTTTTATAACATTTGTCT TGTGGAAATATGTTACAGTTTTGATCTTTTTATTCCTGCCTCTAAAGTCT GAAGAATTATTTTGCAAATATTTTGCTGGTCGCTTGATGCTATTAAAAAC TAAACGTTAAAAGTGATGCAATTGTTTACCAATTTCATTTTTCTAGGGTC GTGACAACTTTATGGAGTTTGAACTTGGAAAGGATAATAACCATTTCACC ATCAATTCCAAGATATCTGCCATTTTATCCTCCGCCAAGAATTTCAACGA CTTCAACGACAAAGTTCATTACATCATGCCTATCTCAGATCGCTTTGGTA GAGGTATTCGCAAAATATATTATATAAAACCCGTACACGTTACTTGAGAA AAAACTATATAATAAGGCTTCGATAGAAAAATTATTAAGAATTTAAGAAC ATTTTGATATTTCGTAGGCCATAAAGCACCCGATTTTCTTAGGGGATTGC ATAGAAATATACCCTTTTTTTAGACTTAAAACTCAAAAGACTAAGAACAT CCGAAGGCTCCAAAAATGTTCTCATAAAAGAACGTGTACTGCTAGTTAAC TTTCGCTTCCTATTCTTAATTGATTAATATTTTTACTCATTTCAATCTTA GGCACAACGATCGACGCATGTAAAGCAGTGGTGGATAAAAGTTCATCTTC ACAAAATCCAATGAAAGGAGCCGTTTGTCTTTCCTTTTTGACCAATGAAT TTATTCGTGAAGAATGGAGTCAAACGGAAAATTCTTATTGGTTCCTTATC AAGAAAAACGGTGAGCCGTCCCAGTCACACAACGTTATTTCGACGTTCAT CTAACGTTATTTGACACTATGAACGTTAGATGAACGTTGAGATGACGTTG TGTGCCAGGTGGGATACTTTTTCGATAAAGCTTCAACAGACAGATTTTAT ATCATCAGATGTTTTGAGTCCTCCCCATCGGGGACAGAAACTACTGATTC TGTGTTCACGCGATACATAACCGAGTTTATGTGTTTGCACTTTTGAGGAC GGTAGAGTGACTGAAACGATTTGGAATGACCCGTAATATCGAGGACGGTA AAAGTGCTGATTTATCGTCTCCGTCGCAGAAAAACACATATACATAAACT CGGTACAGGTATCATGCTGCATGCTGATAACAGGCAAACTACGCAGGAGA GCATAGCGCTCGTCACGGTCGTAGAAAGGGATGAGTGTCAGTACACGCCA AAATATCCGGCATATCCGGTCGGAAGTACGTTTACTTGCCAAGTGAACCG TAGTATCACAGTGGAAATCGAACTCGGACCTTGTACGAAGGCAAGGACCA CCACTACGCCTACTACGATGTCACTTTCATATTCTGAAAAGAATTATACA AAATATTGTTTTGAGTGAGCTCCTTTCTAACTTTAGCTGGTGTTATTTTG AAAGTAAACTTTTAAAGAAGAAAAGTTTGTTACAGGCTATTTTTTATTTT TCGTCATAACAAAAGGTTTGTCATTTATATCTTTATCACAGGTCAAACCT TCATTCATCCGAAATTCGGACAACCACTTGGATCAGATGAACTTTCTCGG ACAGTTAGTATTTTACAAATCGAATCTTCACAAAGTTTCAAAGATGAAGT CTACGATGACATGATAAGGTAATATAATTTTAGAATCAAATCACAGACCC ACTTTTTAATTTCAAAACTTAAACAATAATCTTTTGTCACAATTTGTATA GGGCTACATACACTACACAATATATGAATATATTGATGAACAATATCTGA CAATATGGTTTGTGGACCGTAATTTACTAAGTAAATAGCAAGTACTTTAA TATAAAAAGGATTTTTCTTTCTGTAAAGAATCCTCCTATATTGTTGGAAT ATTGCAAATCCATCTGATAATATATTGTGGAACCTTTTCAATATATTGCC GGCATTCAGCAATATATTATCAATATATTGTCTGACAATATATTGTGTAG TGTATGTAGCCCTTATCACTTCTTTTTACCTACATGTGAGTTTCTAGGGT TTGGTTGAACATCTCAGTCCTTACTAAATACTGCTTCATNTATGTGAGTT TCTTGGGTTTGGTTGAACATCTCAATCCTTACTAAATACTGCTTCATATT ACTATCACAGATAAATTGTTTCTCACTCTGTCTATTATGTTTTTTCCAGT GGAAACTCTGGCACAAAGATATTGCTTCAAGTAATAGCGCCGAAAGGTAG AGGACCATTTGGTGCATCTTCTCATAACACGACTTTGACATATACATGGA GAGCGGTTAGTTTATTTACTTTTCTTTAAAAATGATTCCGTTACAAACAT CAAAAGTTTCAACAATTCTTTTTGGGAGAGGGGCTTTAAAGGGCTACATA TACTACACAATATATTGCCAGGCAATCTATTGGCAATATATTGACGATAT ATTGCTGGGTGCCAGCAATATATTGATAAGGTGACCGCAATATATTGTCA AATCAATTTGCAATATTCCAACAAGAAAATTTATTTTTATAATAGAGTAC CTGTTGTTTACTCCATACATTACGGACCGAAAACCATATTGTCAAATATT GTTCGTCAATATATTGTGTAGTCTAAGTAGCCCTTTTTACATAAGTGTTT CCGTTTCATATCAGACACATGATTGATATCAGGACAGTGTCTGCCTATTG TTATATTGTGCTGATATAAGCAAAAACATGTTTTTCTTTTCCTATTTCTG ACTTATCTTTATGGAAGCCGGGAAGGGTCATTTGGCGATTTCTTTCAAAC TGTCGAGATTTCTTTCAAATTGTCGAGATTTCTTTCAAACTGTCGAGATT TCTTTCCAATAAGTGTCGCGTTCCCAAAAGAATCGCGATTTCATTTTTTT CCAGAAAAAAGGTAGAGATTCCCTCATCAAAACCGCGGGAACATAAACTA AACGCAGGACATGGGTATCACCTCACACACGCGGGAAAGAAAAATAGGAA GCACCAATCGGAGTTAACTGTAAACTACTCCGAAGATAATTGCTTTATTA TCTTTCTTTGAAGTAATTGATAATCCAATTTGTGTAACCGCGACGTTGAT GCGACCACCAATTTTCAATTCTCTGGTTGTTTACAGATTTACCATAACGG TGAGCATTGATATCGTTATCAATGTGGAACTGGATTATAGCCACAACACC CGGGGGGGGGTACTAGGGTAGGCGAATGAGGGGTATGTGCGGACGGGACC TCCGAAAACCGACCCTTAGAGAGACTGAGTTTTGCTGAAAAGGTGACCCT TAGAGAGACTTTTTGAATTTTTTTTTTCAATTTTTGAAAAAAGTCATACC CTTAGCCTTAGAGAGACTTTATTACAATTTTTTTCTCTGGAAATCAAAAA ATTTCCTAAAAATCTTGAATTTTCCGACCCTTAGAGAGACTAATTTAAAA CTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNGATTTTTCCGACCCTTAGAGAGACTTTGAAATGTGAAAAAAC CGACCCTTACCGTCCGCACATACCCATCATCCATTTTTGCCTAAGTACTC CCCCCCCCGCCGGGCCACGACACCATTTTCAGTACCACAATCGGTTTGTA CAACCCTTGGAAGTAGCACTTTGAAATTCTTTAATTGCGTTAATGAAAAA GTTAGCCGGGATATTTGTAATAGTAATGATATGACATTGAGGGAAATTAG GGATTAATACCCCGAGTTTCATTTTGAAATACTTTGAAATAGCACGAACG AAGTGAGGGCTATTTCAAAGTATTTCAAAATGATACGAGGGGTATTAATC CTAATTTCACAAATTATATGATTATATAATTATATGACTGATTTTATCGT TCTTAAAGAGCTATCCGAAATGGGGATTCCAGAATTAAGACAAAAAATTT ATGATGTATTGTAGAAATATGATGTATATTGCTTCAAAACACAAATCATT CCATCCCATATCACTTTCAAATTGTTGCAGATAAATATATCAAAAATATA ATGTCAAACAACAAAACTAATAATCCATTATCCAAACTTTCAAACAATAT TATCGGTAAGAAGATTCTTCATAAAAATTGTATTCTCGGCTCCTTTGCAA AGATGCCTGCATTATTATCCGCGAGTCAGGTTCGTAATCAGTGCCATACT CTTTCTTCGGGTATCTCCACATAAAACATAAAAAATAAAATGGTTACAAA TGAAGTGTTCAAATTATATGGTTCGTATTCATTCGGATATGTTCTCCCGT TCTCCTCAAGTCCACGAGACTTTGCCCATTTCCGAAATGCATTTATCCAA ATGTTCTTGTTTTTGTTTTTAGAATTTTGCCATAATAAAAGAATAACATC ATCATCCAACAGCTCGAATTTGTTGTCATCTTTATACATTTTTCTTATAC TTTTAGCCATAAGCAAAAAGCTCGTACCCATGTCTATTTTTAGCTGTTAA AGCATAATAATTTGAGTTGAGTTCTTTTTCAGGACATGAAACTTGGATAT TCAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNAAAAATGGATTTGAAAGCCTCAAATCATAGATTAACCAGTCCAAGT CCTATAGAAAGTTGACTCAGCTTGCAAAAGAGGCCTTTTGGTTAGTTTTT TGAATCTATACATGAGAAAAAAACCCTGTAATAAGTACATCATTCCAAAG CAGTTTTTTCAGTACCGTAGCAGCAGGCTCAGATTTAGCCTATGTTGATT TTTTGGGAACATATGCATGTTATATATCAAATTGTTGGAAATTTTATGTA GATTTCAAAAATGGTTAAAAGTAGGGGTTAAAAATGAAGTCAATGAGAAG AAAATGCAAAACTTGATGATTTTTTCTCCTATTTTTGGCCTGCGATTTTA CAAAAACCTAAAAAATGCGATAAAAAATTTCTAAAGCGAGGTTAAGCTCT ATTTTTTTTTGCTTTTTGCTGCAAAATACCGTAGCTTCCCATAAAAATAG GTTTTGGAGAGATTTGAAGACCTTCATTTTTTGACATTTTTAAAATTTTT GGATACGAGCTTTTTGCTTATAGCTTTTTCCTCCTTTGATTTTGGTCGAA CGGCTATCTTCAAAAGATTTGTGTTTGTTTTTAAAAAAATCGAATGTTGT CAAAAATAATCGAATGTTTTGGAAATTCGAACACTACTTGGCGCGTGAAA TTATGTTAGGAGAAAATGGTTTTGATCAAAAATATTACTTCTAAAAATAA AGTAAATAATCTTAATTTCTCCTGAATGGCTCAACAGTTTTGTTGTTTCC GTATTTGTAAACTGCGTTTTGTTTGTGGCGGGACGGCGAAAAAGAGGGCG TATTATCAGAAATTTTTTGGCGGAAGCGGGGTATTACAAATCAAAAGCGG GGTATTACAAAATAATACCCCGCCGTAGGATAAGAGCGCGCAACCTAAAT AAAATCAGTCATATAATTAGGGTTGTTATTTGACTTGCAAACTTTGAGCC ATATGATCTTTCTGGAAAAACCATCCACACAACCATGAATGGGAAGTCCG TAGGGTTTCAACTTGTCGTAGCCATCTATATGCCACGCGTCATTAGGGCC ATCAGATTGATAAACACGCCTTCTTAACTTTCTAGCCTTCCTCGTTACGG TGCCCTCAGGATCGATCTCTCTTAAGAGTGTCATTACAGTGTCTCTAGGA GTTGTTATCCCATACGTAGTCCGTAATTTATTCCACATTCCTCGATAACC AATTTGGGAACCTGGCCCTTCAATCTCATTACTTATGATTTGCCGAAGTT GATCGTCGCTGGCTTCACCACCAGCTTTACTTAGCCCATAATCTCTCAAT CTTGTTTTCAATGTGCTTAGACTTATATTCAACGCATGGTTATGAGCCAA AAACAATAAGAAATTGATTCGTATTGAAAGCCCCTTCTGAAATAGTACTC AATTATATCTCTTTCTGTTTCAAGAGTGTTGACGATAATGTTCCGCTTTT GTGTGCCACAATTGCCACAAAAGATGTCCCTAATTTCATTGCCACATTAT GGCAAAACATCGTTAAAGAAAAGCTTGGCACGTGGACTTTTCACAAGTGG ATAATAATAGGGTGATTCCCCCACTGTAATGTACGACGCTTTTTTGGAAG CTCGACAGTTTGAAAGAATTCTCGACAACTTGAAAGAAATCTCGACATTT TAAAAGAAATCTCGACAACTTGAAAAAAATCTCGACACTTTTTGGAAGCT CGACAGTTTGAATGAAATCTCGAAAGTTTGAAAGAAATCTCGACAGTTTG AAAGAAATCGCCAGATGACCTTTCCCGGCTTCCATATATCTTGCTACACA TCCGTATCAATTCAATATCAAAAAGCTTGTAGATTAAAATTGATGAGTAA GCAAACGATATCACTCTTATTTAAAAACAAATCTTTAATTTTTACACTAT TCATATATTTCATCTTTTTCTTTAGGTGCCAAAGTCTGATTTCGTTTTAG CAATTGTCACTTCTTCAGGATTTTATGATTCTAAACTCAAAATTACCGAT CAAGGAGGAGCAGAAAATTATCATCGAATCGATCTTTGGAATTCCACAGA TTACGATGGTCATCTTTGCAAATACAGTGGAACACAAGTCGCAGTCAAAG GTAACATATAACTTAAGAAATTCATGCCAACAAAACACATCCTATCCTTA CAAACTTTAAAAACTAAGAAAATGAAAGTAAGGTAAAAAGGTGGCTAAGA AATAGCCAAAAAATATGGCTCTGACTCTTTTCTGATTATTATACTTTTCG CAAGAGAGCCAGCCAGAACGACATATTTCGCCTTTTCATCTCTGGACCAT TCTTTGTCATTTGACGTGATGTAGAGAATTTCCAAAAGCTATTACACGTA AAATAATTGCTTTCTCGAGATTTCTACAATCCCCACCGTAATATTTGACT CAAAAGGGGAATTCCCTCAAGTGATTTTAAGTGCTTTAAAGTACGGTTGG AAAGTTGAGTCTTAACTGTGAGTTTTAACATGAGACTTCAGACCTTAGGA TCTCAGGATTTAAATGCTCAAAAAATCTTCCAATAAGGCTGAGAATATAG CCTGGAGGCCACCTAACACCTCCCAAATAGAAAAATCCAATGAAACAAAG TGGAGGTACTGAAATCGCAATTCTCGCCCGAGCTTTAAATTCTGACAAAT ATTAAAATACCCAAAAGTGCCAACGTATTTTGATGGGGATTTCTAGATCT CTCCTGGTGTTTAAATCCTTTTCTGAAACCATCGTAAAAATCAGAAAGAT TGAATTCGGCAAACGGATTTTCGTCGCCAGATTTCCGGGCTAGCTGAGAA ATTACGTCATTTAGCCCCGCAAGAATCGCCTATGGGGCCGTCCACATAGT ACATACGCACTAAAATCCCTGTACGCAAGTGTGCGCAAATGGCTATACCC CCTGGCAAGTTACGTACTTCTTCATTCATTTCTCTACAACCATGAACTTT TTATTTTGAAATTAGATATGATTTATATATATCATTTTCTTTCTATTTTT AGACCTTGCAGTCATCAAATTTCCAGCATATGCCTTTCTCAGACCAAGTG TATATTACAAATTAGAAAAAGAAATTGAACTTGTACAACAGCTAAAGCAT CTGTGCACACCTGGTAGTACTACGTTACCTCCTGCAGGTTTTTTCAGGGT TAGTATTCAAAATGAATACTTTGTATAATTATTTTTTCGTATCTCGCCCT GAATTTCATGCCGTTTACAAACACTGTGGTGGAAAGAGTCATGTGAAATA ATTCCCTTTCTTTGGTGTTTGGTATTTTTTCGAGAGGGGGGGGGGGGGGG GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGTACTTAGG CATAATGGGTGGCCGGGTGCTGGGTGCCCTCGAAAGTCTCTCAAAGGGGT ACAAAACCATTAAAAAGAAAATTGAGTCTTTGTAAGGGTTCAAAAATAAC AAAATTCAAAATTTCCTCTCTCAATTGGTCGTGATTTTCCAAAGTTCGGA TAAAAATCGAGTGAAAATCATAAAAATTTTTAGAAAAGTCTCTCTAAGGG TCCCAAAAACGCTGATTTTTCCTCCCCAAGGGTCGATTTTCGATTTTTGG CTTGAACCTGTCACCTCGCAAACCTAGTACCCCGGGTATTTTTTTACCCC TTTTGATTGTACCTAGAAAATCTCTGGTATGTTGGTTGAAAGACGTTAAG AAAATCCACTGTTCAAAATAACTCCTTAGACATGCGGAAGGAATGCTTAT CTATGCGCTGTAAAAATTTCCGACTCCTCCTCCGTCAAAGGCATTTCATT AATTCATTTTATCCCTATTTTTAGAGTATCGACTCTTTTAAAAACTTATG TCTATCAGCCAAAGCCACGCATGGAATGAACGCATTTTGGAACAAAGATA AGTCTGAAGAAACGGTTAACATTTTATCAAGGTTCGAGGAGTTTTTTTTA TCTTCATAATTCAGTAGTCAAACTCGAACCCAGTCTCTAAGCGCTCACGA AAGGTTTGTATCAACGTAAGTAAGTAAGTATATTCATCTGGTGGCTGTTG GCGGAGCCCGGAGTGAGGGAGTCTATCCCCTTTTCTATTTGCGCTAGACC TGGGAGATCGAATGCTGAGGTGGAGCGCCACACCTGCTCTCAGCTCCCAG TAACTTACCGCCTAGATCAGATTACCCAAAGCTACTCATCCGCTGAGTTG GCGGTGACCGGGGATCGAACCCACAAACCTTAGATTTTAAGACGAATGCT CTACCGACTGAGCTACCCGGCCACTGAGAAAGGGTGACTATTGACAATTT GTACCCAAATTTGCTAAACACAGGTAAATATTGTCTAATTTTTAAACGAA TTGAACCAATGTGAATGTAACCTTNGGTCACTGGTATCAACGTACCAGGA GTATAATTAAGTCGTTTAGGTTTGCTTTGACAAGTTACCTGTGGTTATTG GGTTGTTGAATATAAAGTTTTTATTTGGGTTTTATCTTTTTCTATTAGAT ACGTTGGTATGGAGAATGGTTTCTTTCGAGCCTATCCTGGACATTTGATG AACCCTTCGTATGATCCAAGAGCTCGACCATGGTAAGAGATTATGACGTT TTTAATGATGCAGGGGCAGGCAGGGATGCCCGCTTAAAATTAAAATTCTT GGTGTACGCGGGAAAAAAGGGTTAATGAATAAAGAATGAATAAGAACTGA TTTTGAACTGATTTGCTCTAATTAATTTTTGGACCTACCTCGGAGGTCCT TTAAATTAACCGATTTTCATCCGTTCGTCTGTTCGTCTGTTACCAGTTTT TCTTGTGATTGGCTCATTAGTAGTAGTAGGGAGGGAATTAAAGTAAGCTT TTACCTCAAGACGGCAAATCACCGTCAAAAGAGGTCTGCTTTTTTGGGTC GATTTAAAAATGCTGACGTCAGCAAAAAATGTACCGTCAGCAAAAAATGT GGCGTCAGCAAATAAATTATAACGTCACGCCGCTGCATACCGAGCTCTCA ATCGCGCGTTCAAAAATGCGTCGGAAAATCACAAAATTGTAACTAACCAT AGCTTTCACTAAATGCCCCCACATAAAGATCATGTCAAGCACTTATAAAG CTTTAATGCATTAAAGATTAAAACTTTAAAAAATAATCAGGAATAATTGA TTGATTTAATTATTGATTGATTGGTTGGTTGATTGATTGATTGATTGATT GATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGA TTTGATTGATTGATTGATTGATTTAGGCATTTGCTTGAGAAAAAAAATTA TATTCTATTAACAAAATACTTGAAGAATTCGCAGCTTGATAATTTAGTAA AATTTAAGGAAAAGCTGGAAAAGCTTCTCAAAAATATATTTCAAAAATTA TGGTATCATTAGCTTACAGGTTTTCACATCTCCTGTTTGTTTTTTTTCTC CTAGTTTCTTTCTTACAACAATATATATCGTGATTATTATTCACTAAATA GACCTTTTCTGATAATGCCGCAGACATATAGATTGTAGGCAAAATATATA GTGGTGAATAAATCAACAAGGTAACCAATCATAGAAATAGCTTGTTTTTT TCATTGGCTGCTATATTTCAACAATTCTCTATTGCAACTTTGCCTAATAA ACAATAGTCAAGAGGATACTTTGTATGAATTTTATCAAAAAGTTCTGCGC CATCTTAAATAGGGTGAAATAGAAACCAATCCTAGTTAAGGCCCGGCCTC CACTTGCGTACGCAGTGATTGCACTCCTCAAACAAAATCTTCTATTTTTT ATTGGTCAAAAGAAAAATAAAGGAATGCCATTGTGGTCCATTCAGACGTA CAGTCGAGAAAAGTTGAAATGCACCTAAATTTTTTTTCAAGTGCATAGTA CTTTTTCATGATGCAATCTTTTCTCCAAGCTGAAAGGATTGAAGCCATTA GGATGATCGCAGCGCAGACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNCAGGAAGCTAGACTTTTTGAGTTTATAGCTATAT ATACTTTCACTTTATGGTGTTTCTGTATGACTGTCTGTGTACCTAGTCTA ACCACTGTTAAATGCCTTCGGGAAGGTCCGTCCTAACTTGGAAAGAAGGA TTGGAGCTATTTCACAAAACCACTGGAGCGTAAGTTATTTAGGCTATCAC AACTGCATGAAAAAGTTGAATGTGCGCATGTAAAGTTAAACGAATGTAAA TAAACTTTTTGCAGGCTTTTGAAATAGATTTACCACAGTGAAAAAAACTC TAAGTGAGGTAAATCTATTTTGAAGATATGTGATGGTATTTAAAGCTCGA GAAGCTCTATAAACAATAAAGGTAGTTATAAATAAAATAAAAGACAAAGA TAAATTAGAGTTTGAACAAAAATATCAAATGTACATTTGAAAACTTGAGC AAATTTCTGAAATTTCTTTAAAGATTCCGGAAAAAGAATTGAAATCATTG CTGAAGTAACTTCTGACTAAATTTACAATTTCAAAGACAAGAAACAAAAT TTGACATACAAAACACTTTTTCCAGTCAATGAATACATAACCAGTCTGCC ATTTTGTTTGTTTTGATTTGCACAAGTAATATTGTAATTCGTTTTATATC ATACACTGTTATGATTTGCATTTATAACACTCGCTTCAGCTTTTCAAACC TAAATCAAAACTAAAATTGTAATATGTAATAATGTTAATAGCATATAACG TAATATGAAAAATGTATACTACCGTCCCGGAAAAAAACCGAACATTTACG GATGAGACTAACTATGGAGATGCTTGGGCGACAAAACAAACACGCAACAA AATTTCGAGATTCCAGTCCAATATCTATGCGTGAAACTATGAGTGCCTCC TCGTCGCTACGCTCCTGCGGGGGCAAAAATGTCAGATTCTGAAGTTTTGG TGATTTTGGAGGAAATTTTGAAATTTTTAAAAAAAGTGAAATTTCAAATT TTGTTTCAACATTTTTGGATGATTTTAAAAATTAGAAAGTCATAAAAAAT GGTAGGGGTTGGCCGCTGCATCCCGAAAAATGTCTGTGTATGCGCTAGTA AATGGGGAAATCGACGCTGGTTGAAACTCATTTTATAATAAAGATGTTCA AGTTTGGTCAAGTTCAAATTACAAGCAAAGAGTTTAACAGCGAATACCAT GTATTTGACGCTATTGACGTGGAGAAGATCCGAATCAGCAAGGGTGGTGT TGCGAATAAGCACGGCACTCGCTATACTACCGGCTACGAGGTCGAGCCAG GGGATATCATTCCGCTCTAGATCAAAACTCCGAGAAACTTCGTCTTTTAA GGGGTTTCTTGGTACAGCGAAAGTTCGCCCTGAAAAATGGGGTTTTAATG TAATTGGATCAGAAGGCTGGATTCGACAATATGAAGCTATTTCAAAGATG GTTAAAGAGCTTTTGGGTCAAAATTTAGAGGGAGAGCTGTTAAACAACGG CAAGTATGTTAATCTAAAGTTGATTACATGGGACGGTGAAATTAGAACCA GGTTTAGGGGCAATGGATGGAACAAGCCTGAAGAGATTGGCGCCTGTCAC GCGACCAGAATTTTGAAGATAGGAATCGTTTATCGCAAGGGCTCGAACTA TCACTTACAGCGACGACGTAGACAGTGGTTATGACACCATTTACTGAGGA GGGCTGAGATATTTGTGAGGGGGGTAACTCACACATGACAAGGCGGCGAA CAAGATCGTGATGAACAAATTGATGCACTTGTTTAATAAATGACTGGACC AGAAATTTACCCAGTTGTATTACTTGGATCTTTTGGAGGTTTAGTTGGAA TGATTGGTGGTTGTGTTGTAGGTCTCCATGGGAGAACTCTATGAGCTCAA ACAGGCAAATTTCAAAATCGAAATGGAAAATTCTAATCTCAAAAAAAATC AAAAAAGATCTGGCGAGCATGAGTGAAGACAGTGGCTATGACACCACTGA CTAAAGAGGGCTGAGACCATCTGTGAGGGCGTAACTTTCACAAATAATTG TACTCTGGTGGAGGTTCAAATTTAACGTTGGCAGCCTGGGTAGCTGAAGA AGCGACGATTTTCGCTAAAAAATCCTTTTTGCACTCTTCTCGGGCTTGTG CTAGGATTGACTCGCGCTGCTCAGCGGTAATCTTGTCGACTGCCTTTTTG AACTTGGTTCTGGTCTGCTCCTTCATGGTATGCTATAGTGTTCAATCTCT TTTAGTATGAACTGGTACTTTTCTTGGGAAATGTGGGCGTCTTCGATGGC TTTTGATACAAACTCTGAGATCGAGTCGAGCTTGATCTTATCGTGCTTTT TGGCCTTAGACTTGAAGATTCTTTGAGTTAGGTGGGTGACTACAGAGGCA ACACCAAAGAAGAGACCAGTTGGGGCTAGAACGAAGCTGATAGGTATTCC CACGCCTGTCGCCAAGGTCACGATTGATGCGATCTTAAGTGTGGTGATCG TCGAGATGACTCCTCTATCACTGATCGTTGTAGCTATCGCTCGTCGCTTG AATTCTTTTTCTCATTTTGTGTCTCGTTTTTATTTCTTCTCGCAAGAACT TTTCGTTCTATTCGATCTTTTTGAGGCGATAACTTTGTGCCTGCTCTAAC TCTCGCGGCACGGAAGATGACACTTTAGGGTACAGCTTTTCTGCGTAAAC GCTCGTCATTTATTGTTCAAAGGGAATTTCATTTCCGAGATCATCTTTGA TTCTAATGTGCAGTTTTCTGTCGTTGTTATTTTTAAAAGATCTTGAAGGT AGTAAAATTGGTAATTTTCGATGTTTTCAAAAGGCAACATAGCTAGAACA TCACCATATTCTTGTATCCCGAATAGACGGGAGGAGGGGGTCTGAATAAG GAGGTAGTAATAAGGGGGTAGGAAAATTTTCTAAATTCTAATAAGCGGGG GGGGGGAATAAGAGGGGGGAGACAGAATTTTTAAACTTATATCAATTTCA ACAACAAAAAAGAAACTTTAACAAATGAACACGTAAAATAAGAACCAGCG TTGCAGGAAGGGTAAGCATGGATTTATTATACGCTGGTTCATGGCTGGAT ATACAGGGTGTCCCTAATAAAAGTATCGAGTTTGAACATGCGATTGAGTA AAAATGTTTGTGTGTGTTATCGCTAAAATATAAGAACGTTCTCCATCACA TAGGCTCATTACAAAAGGTAGTTACAACGTATAAATTAATCGTAATGACA AAGAAAAAAGAGGGAGAGCTTAAAATACAATTTTGTGAACACACTTAAAA CTTTCTACTCAATCGCATGTTCAAACTCGATACTTTTATTAGGGACACCC TGTACAAGTAACAGATTTTTGCCGATTTCTCGTGTACTAGCTATGTCCGC AGTAATGATATTATTGTTCACTCTCCTTCCCTCATTAAATGATTTTTTGA AGCATTTTCATTGCATTTTTTATCAAAAATCACTCATCCAATTCCCAAAA GAGACTTCATCATCATCATCCTTCGACCGTTTGGTCGGAAATAGAAAAAG AGACTTAAAACTTTGCTGTGAGAGTCAAATTCTTCCTCTTAATTGCTAAT TATAAGTCGTTATGACGTTTCAAGCTGTGAGAAAGATGCAAAAGATGTGT TGTGTATAAGAAATTTAATGTTGACACCGGAAATTTTCAAACTTCAACCT CAAAAAAACCACTTTGCCACCACGTGCCTCCAAAGGATTTTCATACCACA GTGGAGCCAAGACACTCAAGTCTTATGTATGTTAATTCCACCTCTTCTGG GGACAGTCTTGGAAAGATATTTCCAATTGAAAATTTCGTGTCACTATAAG CATTTTGTCTGAATTTCTTGTCTATGTAATGATGTTTTTCTCACATTACA TTTCACAAATGTATCCACCTCGGAATGCTAGCCTTACTTTCAAACTTTTT TTCTACAAATGTACAAAAAAAGAGCTAGAGAACTTTTTAAAAATAAGACT GATAAACATTTCCAAAAATCAGACATCTTCGAGCCGCCATGACAGTTGTC CTTTGCGGACAAAGCTAGTACATCAATTGTTTTCTGAAACAATGAAAATA CAACGATCGCTCTCCATCGTTTTCTGAGTCGTTTATCCTGTATAATAAAT CTTTGGGGTAAGGAAGATCCACACATGTTCTGAGGCTGCAATGAAGGTTT TCTTCAGGAAGTTAAAGATGCCAGCGATGATAGAGCCGACGATTCCTGAA ATCGCAGCTGCTGCCTTTGCCGCGAGTCGACCTTGTTTTTGACCCATTCT TTGACTGAGTTTGGATTTTCGGCGGGAGTTTGGAGATCCCACTGCAGGAC CACCTGTCAAGGAGGTGACGATGGTTGAAATAAGCAGCCCGACAGCGGTC AAAGGAATGTGAACTTGCCAGAGTGCTTGCGTAGCTAGCCACGCTTTTAC AACTTTTAACGGCTTTTTTGATGCGTTGCGAAGCAATTTGATGGCTTTGT GACCCGTTCATAAATTTTCTGGCTTGTAATAGATTTTACCCAATTCTTTG TTGTTCATCTATTTGATCAACTGGTGGCAACTTTGTTGCCCGTTGGTCAT GTTGATGCTGCATAAGGCCTTCAGTGTGGTTTACCGTATGCTCTGCGATC AACAGGGGTGCCAAAAATCTACCAAACTTTCCCACAATAAGAGCTCCTAC GTCAGCAAACGATTCTTTGATGATCGTTTCGCTGTTGATGTGTTTTCAGA GCCGCTCCACATTGTCAATCTTGAGGAGACTCGAGACACCCTTAGAATAC ATACTGATCACGTGGGCGCGCAAGGCTTTCCCTGTCTTCTCAGCTTTGAG CCTGGCGTCAGCCTGGAGATACTCGTGGTGTAATTTTTCAATGACCTTGT CTGTGGCTTTCCGCAGCCGTTTTACCGTCCAAGGTGTCTTGCCAGGAATT TCTGACATCGTTTTTATTACATGGCGGAAGCGCCAAAAAAATTCCAAAAA TTAAAAGATAAAGAGGAAAAACCAACAACAAACACAATGACATTTTTTTT CTTTATTTTGATAAACAAACGAAAACTCTGATCGAGACCAGAGAACCCGT AGGTTTTTACGTGCAACTTTTCATGTTTCCTCGGTCCAACCGGCACTCCA CCCCAGCTTCTCAGACTTGCGTCTCCACCGGCTCTGAGCTCTACCCCTGA ACCTTAGACTTTTTTTGTCATTTCTTTCTTTCGACCGGGCTCGGTCTTTT TGTTGAGTTTTGACGTGTACTCTTCACGTTTGATGTTTCTCAAGTGTTGC CGACGGCGATTTTGGAGTTATTTTTGATTTACAGGACACCATGCCGTCTT TAACGCCTCACATCACGGACTTATGGGACGCTATGACACGTCAGAGGTCC TTTCGACATTTTTGTAATCTTTGAAACTTTTCGTGAGAACTTTCAGAGGC CGTTCAGCTCACAGATTACATGCAACTAAGATCAGAACCTCGTACGCGTT AACGAACTTTCAGAGGATGTTAGCTAGAGTCACTACCTGAGATTCATTTC GTGGGTGTGACCGGTCTACTCAGCGCCTCAGGGGTTGGCTTTTTTTGAGC TGAACACCGTCACACCGCCGTATAAGCTCATTATTTCCACCTATATTCTA TATTACCTTTCCACTGTATGTTTCAAACAGTTTTGTATTTTTTTCGCTTG TGGTTTACAAAAATATTGTTTGGGTTTTTCCATCTTCCCAGAAATCTTTT CTCTCTGCTGTCATGGTAAAATATTTGAACATGATTTTTTGAAAACATTT CTGTTTTCAAAAAATTTTTCACTTTCGCTCAGGGGAGGCAAGCAGTTAAT ACACAACACCTATGACAATTAGTACGGTGGTGGGTCCTTTTCTGAAATTT GCAAATTGCAGTTAATACACCAGTGTATTAACTGTCAAAGGGGGTGGTGT TAAGACAATTTTAGAACTCAAAAAGTGTATTAACTGCAACTAAATGTAAA ACTAAAATTTGCTAGAACTCAACATCAAGCTGCATCAAGCCAGATCAAAC CCAAGTTTTTATGTCTTATCTCAGCATAACATTTTGTAAACATTTGATTC CTTTCAATCAAACGTTCGATTTAATTAAAAACGTTCGAAAATGATGTTCT AATCTAGTCTCGATCTAGACGATGTTATCGTCCGTTTACAGTGATAATAA AGGCGGGGAAAATGGCGGTATGGCGTTATGGCGGTATACGGAAAAAAATC GGCGGGAGAGTTTCGAAGAAACTGTAAACATCTCCGCCACTGCTTACTCC ACCCGAATTTATCACGCCTCTCCTAAACTATTCCCTTTTTTAGTGATCTT GTGTAGACGATAGGATCGTCTAGTCTCGATCGGGAGAAAAAAACAAAAAC AAAAAAGCAAGATGGTAGAAAGAAAAAAATTGAGGTCAATTCTGATCGCA TCTGATTGCATGAAGAGATCTTTAAAATTATGTTTTGGCACTTCCTATAA ATTTAAAACTAAGCAACCATTCAACTGGAAAACCTCAAAACCTTTTTCTG CTTAACTCAAAATCTAAAACTTTAACTTTTGCATTGCTTAGATAAAACTG TCTGGCAAGGGATTTGCACCCCGACTTACAAAAACTTAATTTAAATTTTC TAATGACATAAATCTGTGACATAAGCCCGGAGGGGTACTTAGGCAAATGA AGGGTATGGTATGTGCCGCCCTTAAGGGTACCTCTTGAAAACGTCGTTAT CCGCCTGCCTGCGAGCATCAGCTACTTCTTGTGGAAACTATGCAAACGGT ACTGGAGAAACTGATGAAAAGCTGTCACTTTCAGCCCGTGTTCACTTGAG AAGAGTGTGTAAATTAGGAGCTTTCGGGTATTAATCAAACCACACAGCTT ACGCGTGCCGGGAATTCGCTTTCTGTAGGTTGATTCATGCGTATAATCTG GTCATTAGGTATCTCCGTAACAACAAACAGCGGAGGAATTTCGCTGAATT TGTCATGCAGCTCTGATGGAACCTCTATGTCAACTTATGCGAATCCAAAC AACCAATCACTCTGAACACCTCGTGTTAACATTTCGAGGTTGTGTTTTGC TTCCGGTGTAGGAACCTTGAAGAGCTTCTCCTTTCCACATGAAAAATCCA CCATTAACATACTAGGGTAGAGCATATTCGCATCGAACCCTAAGACGGTC TTACAAAAGTTTTGGGTTCTCGTACACGTGAGATCTTATGCCTGTGACAT CCCGCTTGTGATACCTGGACAAAAACAATAGCGGACCACCCACCATGCCC GTTTGCAACAATTCGTATGCTTCGTTTTTCGTGCATTTTATACATGAATT CTGAACCTTATTGCTATATAACTTTTACCATCAGGTTGGTCCATTTAGCA TCTAGCTTGTTATATTTTATTTGAACCTTTATAATACGAAATGTGAATTT GAACTTATTATTATTATTAACCTTCTATACATCTAGGTATCGATTGATGA TTGCACAAAAAGGAATCACGTTGACAACACCCTATCCAGATGCCTTTACC GGTGAAAATGTCATGACCCTCGGGAAAGTTCTACTGAAGTAAGAAACGAT ATATCCAAACTCAATAGATCTTATCGGGGTTTTTGATTTTTCTAAAAANN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNGGGATTGTTTCGGGAGTATTACAATAGGATTCCCT CGAGGAATTCCTAAAAGATTTCTATTGTAATACTCCTGAAACAATCCCAC AATGCATTGCTCAAAAACTCCTATAAGATATATTCTATCGACCTGTTTCT AAGATGTGTTGATGTGTACATCTCTGAAACCTCGGAGGCAGGGGTAATCG AGGCTGGGATGAGTGTTGGATATGCGAGATCGGTATTAATCATTTTTACG ACCTTCCAAAGTCTCTTTAAGGGTTAAAACAGTAAGATGAAACAGCCAAT CAAAAATTTCGTTTTCTTTTTTTTATTAAGGGGGGGGGGGGGNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATGTTCCC AATAGATCGAACTAAAAAAGTGTCTTGGGATTTTTTTTGGAATTGACTTT AACTCTTTAAATCCTAAATTCTGTAAAAATATCGATAAAAAAGTGAATTT AAATGTGTTTTTTTTCAGTTATCTGTAAATTGAGGAAAAACAACTCGGTT AGAAATAAAATCCTAAGACACTTTTTAAGTTTGATCTTTTGGGAATCTCA TAAAAAAAGAATGAAGTCGGTATCTAAATGCTATGGGTGACTTTAACTTC GTTAAAAGTAGTATGGTGTTGTAAAATTTCGTTTTTTCCTACATTAATTT GAAATTTTTAACGAGATGATTGCTGTTTATTTGAGTAATCAGTGAAATGT GTCAAAAATATTACTATTCAATAGAGGTGAGAATAAACATCAGCTGAATT CTCTCTTTTCTCTTTGTTGTTTCCGAAACAGACAATTATTTGAGTAAATA ATCCATCATGAGACGAACTTAGTTTTGAAATTTAAATGGTTATAACTCTG GATCAAAAAAAGATTTTAAGATCGCGATTTTACCAAAATGAAATCCAGTA ACTTTTCTTCCACTTTGACTGAAAAAATTTTTTTTGACAAAAAATCGGAA AAAAGGTGTACACATACCTTAAGGAGGTCATTTTTTTAAAGTTCAAACCT TCGCCTGGTTTTTACTAGAAATCTGACTGACCCCGCTGTATTTTCCTGAT TTTATCATGGTTTCCGATGACGATGCATAAATTCTTTTTGGATTAGCTCA AAGTTTTATTTTTATTTTAAAATTTTTGATTTTAAACTGTACTTCAATAT AATTTGTAAAGAAATCAGGAACAACAAGACCCTTGACAACAATTTCTGGA GGGGGGATTGTTTTCTTGACTTGTCCAAAAGATAATGTCTATTTAGAGTT TTCTTGAGAAGGAGTAAGGTAATTAGGGCACTTAGCAAATATTTGTATGA CCATTTGATGGCAGTTACGAGCATTCCTAGATCAGTTCGGGAAATTGCAT AGATCTGCAGCGTTGCGAAATTTCGCATTTTTTGCGTTGTCATATTCCGT AGCGCTGCAAAATTCCGCAGCTTTACTGATAGATAATTTCGCAGCCCTGA CCTATGGACCAAAACCAGGGTACAAAATAATGTGCATTTTGAAGAACAAC CCAAAAGAGGAAACTTTTCATCCAAGCATTTTAATTTCCTCCCTAGCGGT TATTCACAATCATTCTTGGAAGAAATGCTACTTTGTTCAAATATGCCAGG TTTGCCTCATTTTGCTTATATTTAAGAAAATTGGTCGTCATAGTTGGTGT TCATAATCACACACTTCCATTGGGAACGTTGCGAAAAATTGCAGCGCACG CTGAGGGATGCGTTACGAAAAAAGCAACATTGCAGAATTTTGTAACGTTA TGCGGATCTATGCAATTTCCCGAACTGAGATGTGAAATGTATTGATCAAG AATATTGAAATCAATCATATTTTCAGTCATCATTGCGTTGTGATTGATCG AAACGGTTTCGTGGTTTATCAATCGAGTTTTATGGAAAAGAATAAAAATC CAACTCTCGAAAATCAACACATCGTAAAGATGGTAAGCTTCCATCTTGAA TTGGTGCTTCAAAATTCCAAAATTGTTTTTAAAGTTTTCTACTAGCTGAG AATTCAGGCAAAATATTAAGTAATATCTTAGATCGCTAACTCGTGTTATA ACCATAGATTTATAAAGCCCGAAAGGCTAGATGTCGTGCTTTACGCCATC GCAGGCAAAAAAAGTGAATATAGGAAAACATGTTGTTGCTATTGTTTTCG AAAACCTGCGAAGCTTCTGATTGGTCAAGCGCTGAAATTCTATTGTAATG TCACGTGACCTAGGTAGGATTTCCTACCTAACCACGGCACACTTTTCAGC AAAAGTACGCCATCTAGCCCTTCGGGCTTTATAAATTTATGGTTATAGCC AAGCTATAAACCTTTTGGATATTGTCTTATTGTCACTCGACGGACAATAA AGTTAAGGAATTTTAAACATTTAGACGTGTTCAAGATAATTATCAACAGT AAATTCTCTATCCCACTGCAAACAATTGATTGAATATTATTAATAAATTC TATGCCCAAGTACAGCCCCATCTCACAGACCCACTGGGACCCCTTCCCAC TGGAAAAAATGTCCAAAATATCGTCCACGCTGGAAAATGATTCTACAATT TTTGTCCCCACTTAAAATAATCAAATAAACCGATCCTCACTCTCTTTTTC CCCATCCCCACTAAATTTTCTGGCTTGAAAACAAAAGAATTGAAATCCCC AACCATAAAAATTATGGGAATATTAATCCCCATTGTGTTTTAGTCGGTAA TTTTTATCCCCATTGGCTGAAAAATCCTACCAGGTCTGCGAGAAGGGGGT GTCCAAGTTCTTACGGTTCATCAATTATACTGTAGAAAAAGTTCTTATTA TTTTAGCATGGCGTGGTTGCGAAGAGTATGATAGAAGAGGGAGTGATGAT AAAGAATTATTGTTTGGAAATCAGAAATAATATAACCATCAAGGAATGGT TTTATTCCGTAAGTTTCTTTAATATCACATTTTTTGAAAATTATTTACGG TAGACGAGGGATCTGTAAAATTCAAAGCCAAACATTTCTTTTTCTTTGTA AGTTTGAAAAATTACGTATTCTTTATTAAAATTAATTCTCACTCTTGGGA TCCTGATAGACGGGGATTGTGATAAAGAGGTGAAGGCACGGTGATCTTTC TGTGGAACATTTAGAAGATCGGGATTATTTTGGCTAGTTTACCCTGATCT CCAAATGTCCATACCTTCTCGGGGAAAATTTCGTCGAGGAAAATTTTCGT CGGGAAAAATTTTCGTCACTTGCTGGTAGTTGGTAAACGCATTAAGGCCG GGGAAAATTTTCGTCGGGGACAAATATTCGTCACTTGGCCAAAATTTCGT CACTTTTGCCCGACGAAGTTTTCCCCGATAAGGTATAGAGATGAAATTTT GCACACAAAGTCACCTCATAGAAAGTCAAAAGTAGAAAAAAGAAGTTTTT GATACATCCACCAGATCATAGGTTCCGGGACACTTTCGTTTTTGAGAGAT CCCTCTATCGCATCCTCATCCCGGGTGGGATCCCTCTAAATCAGAATCAA GATAATAACGGATTAAAAAAAGCTAGAAACTTAAAATTTTGAGAGAATGT GCTCTTTTATGCTCTTATGGGGTGGCAAATTTTAATTAAACCATTACCGA GAGGTTTAAAAATTGTACCCTTGAAAGTATAGACTGTATATAATCAAGCA AATTGGAGCAAAAATGAGGAACTTTATACATCGTCATGACTTTTTTTTAT CATTTTTCTATTTCAGCTTGACCACGTGACAGAATCAAAGAAATATCAAT CGAGTCGAAGTAGTTTGGATTATCGAGTTGTACCTATAATTGGCTCCAAT CTATTATTGCTATATATTAACGGTATTAACGATTGTAGTGGTCTAGAAAG CTGCAATTGTCAAGACCCTACTGATGGAGTAAGTTTTATCAACATTTCAG TAGAGGGTATTTTAATGCCTCAATGATTTCAATATTACTCTCGAGTACCT AATAGTCGGAGGGAGTTGGAATAAGCGGGAGGGAGGGTTGAAAAAAATCT CAAAGCTTAGTAAGCGGGGGGGGGGGGGGGGGGGGGAAAAAAAATCAGAA GTAGTGGGGAGGGGGGGGGGGGGGTGTTGGAATAAAAATGTCCTGGGTGG AAAATTTTGAAAAGGAGGCTAATACAGCAGGATTAAGGCAAAAGAGGGAA CTTTTAAAAACATTTTCCCAAAAGTTAATAAGTGGGGGTTGGAATATGAA TGTTCTGGGTGAAAAATTAATTAGCGGGGGGCGCTTATTAGGTACCCAAG AGTATGTGTTGTAGAGCTAGTCTTTCACGATCCTACTGGTGGGGCCAAGT CAAGAATTCGCTTGCTTCCACACAATGGTAAGAAAAAGGTGTTTACATTG CTCTTTTACTTAGGTCTTGTTATTTTTGTGGTAAGATTAGATCCAGGTTG AAATAGTCTCAGATAAAAATGAGAGTTTTTTCAAATAATATATACAAAAG TCCAAAATTTCCGACCCAACGGTATTTGCAAATATCAACCTTAAGGTGAT TTTTCGGAGGGGCCAAAATGGGGTAATTTCCGATTTTTGCCCACAAAAAG GTTTCCCGGGCCTAATTCGCGTTCTCCCTCTCACCTCTCAAAAATATCTT ATAGTATATACTGTTCTTTCGGATGGACTAAAAATGGCTAGGTCGTAAAA AAGATGTCACGGAACTCCAGGCTTTGCCCACTACTTTGCCCACAANGTAA AAAAGATGTCACGAAACTCCAGGCTTTGCCCCTACTTTAATTATGTGGTT ACAATGCTTCATTTTTTTACCAAGAAGGTAAAAAGTGAATTCTACATTTT ATCATTTTTCAGGAAATATTTGGGTATTGTTCGAACGATATCAGCGAAAC AAATTGTGAATGTCCTTGTATACAACCCGTTACTTGTTTGAATGAGCTAG ATGATACGTAAGAGTTTTTTATAACCCTTTTGTTTCCCCTATTCTGAAAT CAATATCGAGCTTCATCCAGGGGGGGGGGGTACTAGGGTTGGCTTGAACA AAGTTGTGTTCATCGTGCACTTTTGAGTTATGGAGACTCCACTATTTTCA CCTTTCAGGGGCTTTTCATATTTTTAGGACCAAACTTCAATGNTTTATAA CCCCTTTGTTTCCCCTATTCTGAAATCAATATCGAGCTTCATCCAGGGGG GGGGTACTAGGGTTGGCGGATGAGGGGTATGTGCAGACGTCCGAAAACCG ACCCATAGAGTGACTGATTTTTGCTGAAAAGGTGACCCTTTCCTAAAATT GTGAACTTTTCCCATTTTAGCCCCACTTGCCTTATAAACCTTACTCCACA ACTTGAACAAAGTTGTGTTCCCCGTGCGTGTTCAAGTTATAGAGACTCCA CTGTTGTCATCTTTCAGAGACTTTTCACATTTTTAGGACCAAACTTCAAT GTTATCCAGAAGACAAACGTAAAACGGACTTTTCAGGGAGATGGTATAAA GGAGATCTTTCTTCTTTACCACTCTGTTTTGATCCAGAATGTAAAACACG GTAAATGCTTTTGTGTCATTTTAAAATTTTATTCTTTATACAAATAAATT TATTCTTTTTGGGTACACGTTTTTTTATAAGATGGTGTAAATCCATTTCA TCATGTATATTCTTAACTTTTTTGGGAAAATCACCCTACAATATTCTTAC AGCATTCTTAGGCTAGGATCCTAATTCAGACTAGATTTAACATTTAGTAC ATAGCGTCTCAAGCCTAAAATGGTATTTTTGTGAAAGGAGTGAGCTTTTC TTGGGGGTAATTGACAATTGAAAATTGAAAATGCTCTAAAAATGGCATTC TTAGCTTGAGTAGCATCATGGCAATATTCTTAGCATTATTCTTAATTTTT TTGCCATTTTCCTCATGGACATTCTTATAAAGAGTATTCTTATTAAAAAA GCGTGTATCTTTTGTTTTGGATTGCTTGTATTTTGTCCTGAAAAACAAAG TTGAGAAACTGAAAAACTTTTTGTCGCAGAAATTCATATGTTTGCTTTTT CAACGTGTAAGATTTAAGTATTTCGAGGAAAAAACAAACTCTATGGTTTA ACTCACTAAAACTTTTATTGATTGAACATGTACAATTAATCTTTAGTGAG TTAAACCATAGAGCTCTGTTTCCGTCCACTGATGTTTTTCCGTGACAAGG AATCTTTCTTTATAGTCCGGATGTTTTTCATTGAAGCAGTGAAAGCTACT TAACAATTTCTTTACTAGGAAAAGTTCTGGTCAGTGTAATCGTTTCAAAT CTGGTTGCAATTGGTGTCATAAATATCCAAACGGAACATCCGCGATTGAC GATCACAAATATTGTGAATACTCCGACAAAACATGTTTCCCAGATTTAAT TCCTTTACGACGAAAGAAACACCATACTGGCAATAACCCACTTACATTGG AATATATCATCATAATATCAGTTCTCAGTTTTATATTATTCATATGTTCG ATATTGGTTGGCATTTACTTTTGTCGAAAACGAAAAAATAACCGCAGAAG ACAATCGCCTACTTCATCAACCGAAAGTCAAGATTACCAAAATCCAAATT TCTATAATGATGAGGATCCTGATTACTTTACGCCCTCAGGACCACCCCAA CGCCCACCAGAAACCCCCGAATTACCTACGGTGGAAGTAGGAGCGGCTCG TGATGTAGTCTTTCATATGCGAGTTGACGATGCACAGTCACCAGCGTCAA GTAACGGAAATTTTTTCCCAGATTTTAATAGAAAGTATCAAGGTAACGTG GAGATCATTGAAGTATAAGGTGTTTTTTGATTTTATAAATAGCCCTTATG TATTCGAATGAAGAGGTTCCCTATGGGCAAGCAACGGACGATGGACGTCA ATGGACGGCTTTAAGACCTTTGGACGTCCTAAAAACGTACATTAGAGGTC CAAAAGACGTTTGTGCCCATTGGGTTCGTTCTAGTGGTTGGTCAGAAGAC AACATGAGAGCGACTGTATTCACTTCATTTTAATTAAAGTCTGTCCAGAT ATAATTGGCAGTGGAAACAAGAATGCCTGTAACTTTTGATAGTCAAATAT AATTATGGAAATTTGTTTTGCTTGTTTTAGAGNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNAACAGAAAAGTCCTTCGGAAGATATGGGACCCGAAATACCCCTTGGT AGCACTTTTCTGTGAAATATCAAATCTCCAACTTATTGCTAAAAACGGGG GTAGTGATACGATTGATAAAACAGTTTTTCGATCATAACACATTTTACGA TCTCTTTAATGACCTCATAGCCAAACTGTATTTAGTGTTTTGGGAATTAG CAAAGTTCTTTAATGACTTAGAAATAACAAAGGCAATACTTTAGTTAAAT TTTTTCTATTGCTGGAACATTGGAGAACATTGGAGAATATTATATTTTTT GACGAAACGGTCATTAACCATATCAGAACACTTTTTAATTTGACAAAAGT TTTTTTCATATCAGAAATTTGATATATATTTTGACGGGGTAAATTATTGA TGTAGATCTTTATATCCAGCGTAAGTATTTCTTAGAGTCTGTTAAATTGC GCGCCCTGCGCGCCTTCTAAAAAGTGGCGTTTCTTGCGCACCTGCGCTCC CAGCGCGCCTTCTATTTTTTGTGTGCCTTTAATTTTCAGCCTTCGATTTT CTGTGTGTCCTGAAAAGCTTCTAGACAGAGATTTTAAACGCTGTATAAAA ATACTACAAAAAATCTTTTTGATTACCATACTACAGTTAGTCTGAATCGC AGACCTCTACAAAACCACAGGTAGTATAGGTCTGCTTAATGATCTACCAA CCGCTTTCCGGTTCGCAAAGGAAATCTTGGCGAGTAATTTGNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNAGGAAATCTTGGCGAGTAATTTGATTGACATTGATGT GCGCGCAAAAACGATCGTTTCGAACGTTTTCAATGGAATGTTTACATTTG AAATTCGAATCCAGGACCAGAAAAACAAAACAGAAAAAAGATAAAAAACA ATCTGATGCGCGCATTATGTACAGTCTGTAGATTTGTTTTTGACTTTTGC TTTTATAAAATATCTGGTCTGTAAATTTATCAAAACTTTTCCATCAGCTC TTCGGTCGAAGCTCAAAAAATACAAATATGAACACAAAAGTGAAAGAAAA NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAAAGGCC ACACAGTATTAAAAAGTGAAATGCCAAAGCTGAAGAAAAGTTCTTTGTTT GTTTTAACATTTAAAGGCCCTTGTTGAAGGAACAACAACAGGAACACTTC CTTTTGTAGAATCATAAAGAAGTAATGTCAGAAATATTCAATACAACCCC CAAAATGTACTGTATATACATAACTAGAATACCTTGAAATAANNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNTATCGGCTAAAGGCGGCAAATCTCTGGAC AAAGGAAATATAGCTTATTAAGCATCCTCTATAAGGAGCACGAATCCGTT AGTGGATGCCAGCAGCCTATACTACAGTATGTATGACAATCGGTTTTGCA ACGGTAGAATACTACATTATTTTGACCATTAAGAGTATTTAAAAGGAACT AAATGGTTCCGAGTAACTTGTGTCATTTTTTCGACTAGCCATTTTGATTT TTGATTTTTAAAGCACACCTCAGTGTTGTCATTTCTTTTGTATTTCGATC TTGTTATTGATTTTGTAAAATTTTGAAATCTTTTGATTCAGACTTTACGA GTTAGTATTTTATTATTTGTTCAAATTCGATTCTACTTTTTGATTTTGAT ATGCAAAACTGCATGCACCATTATCTATAAGCGCGCCAGAATTTGAATAA TTGAAAACATTTAACCATTTGTGCGCCAGGGCCCTTTTTTGTGGGCTTTT TTGGTAAAATGAGCTAGATCAAACTTTACACGTCATTCGGCATTTTTTTT ACTTCAATGGCCAAAATCTCTCAAAAAAGACCGAATTTACAACTTTTTTG TGTTGATTTTGAAAGTGCATTTCATTTGCATCAACTTAGGCTAAAAATGA AGAATTCAAATCGAAAATGGGTCTGACAGGAAGGCTTTGCCCTCCTGCTC CTGCATACCCAGCCATTATTGTAATTTCGTTTAAATTTTTTAAATGAAAT TTAGCAAATATTTTCTAATAATTTGGAGAAAAGTCTAAAATTTATCCCCA AAAGCATGACACTTGTTAAATCAGAAACGCGTAAAAAATTATAAGGCGCG CAAAAATTAGGGCGCGCCAAAAAATAGAAGGCACGCAAAGGCTCCCAAAA AAGATTAAGGCGGGCAAGGAGCGCAGGCGCGCTGGGAGCGCAAGGAGCAC CACTTTTTAGAATGCGCGCAGGGCGAGCAATTTAACAGACTATATTTCTT ATCATTAATTAGTTTTGTATAGCTACAAAAAAATGTTTTTCATCGCCAGG AATTTTTTTGTCCATTTTGCACAATGGGGATTTCAGAATAATTTTTAAAA TGTTCTAAATTTCGTTAATCTAGCAAACTTGAACCGAAGTCCCTTAGTTC GATATTTCACGATTCTAATGGCGCTCACGAAAGATGACTTTTAAGTGCAA GCATCCTCTAACGAATTCGTGCTTCTATACTACCAACGGTTTTTGTCTGC GGGTACGAGATTCAGAGATTCAGAAACTGGATTAAACTTGTTCATTCGTA TTTATATTTTTGGTGCATATGATTTGGTATTAAGATTTAAGCTGATTATG TCTTACATGCAAATATTGTGTAGGTATAAAAGGAGTTAAGAGTATTAAGA TTTATAATGCGAGCTTTCCTTTTCTTAACTAGCAATATTCAAATAATGAA GCTGCCAAGACAGACTTTTTAAAATGATGATTCTCACAAAAAAAATCACT CCTGGTTATTTTAAACTTAGTTTGTCCGAAAAAAAAAATTGTTTATATAA ACTATAAAGAAAAATCCTCAAAATAAGACGCTTCATCAATTTTTTTCCAT GCATATTTTTAACTTTTTGACAAAAATTATCCTAAAATATTCTTAACGGT ATTCTGAGCTCAACCTAACTAAATGTAACATTAATACATATACCTGGTCC GGACATATCCAATATTCCCCAACCTTAGTACTCCCCCGGGAACTTTTCAG ACGTATTTTGTGGGTTTGAGACTATACAGAGTATGACATTAAGTATTTAA GCATGAGATAATAATCTTAAAGTTTTTTTTATATCTCGGTTTTATGGTAT ATCATGCATATCATGAGACTTTGGAATTGCTAGCTGTACTTATAAGAATG TATTTTTTAGTTACGGTATTAAGAATAAAAATTTCTGTCCGAGGAAAGTT TCATACTGGAATCTTTCATGGAAATTCAATCCTGAAATTGCTTTAATTTG ATAATTAAAGTTTGAAGTTTGTTGGCATGTATATACTAAACATTCAAATT TTTATTCATGATGAGGTAATTACAAAAGTATGTTTAAGAAAAGTGTAAAT GTTTCCAAAAATGCATTAGATAGCCCCCTCCCCTAGCGGTAAGTCTGGTC ACGATATCACGTAATTTCTGTCTTCACAATTACGAAAATCAGCAAAGACA ATCGCATCACGACTCAAAAATCTTTCAAATCATGATCACGTTTTGACATC TAATCACGCAATCACGAAGAAAAAATGTCCAAACCATGTTATCACGCAAG AAAAAGGTCCTTATCACGCCATTACGAAAACCGAGGATGTTTGGGGGTTT TAAAAACTAATTCGTTTTACAATATTTTTTTGCTGGGTTACAGAGACAGG GGGTTTATAACTTCCATACGTTGTAGATGACATCAAGAAAACATTATTTG ACAGCTAGGGGCATTTTATAGGATTGTCTGTTAAGATACTTTATAAACCC TTTAATCTTAAAAAAGGAGATATCATCATGAGGTATTTGAGGTATTTTTC CTTCTTTTCTCAGAAAAAAATAGCAAAAAGTTTTTAGTTTTTTTAATGAA TATTACATATTATGTTTTATAAATTTTTATTGACCAAGCTGTAGAAATGC GTGTGTGAGGACGGTTATTCGGGATACGATAAATGATATATAATTTTCAT GTTATAATAGTTGTGGCTGCTGTCAATTAAAATCTTAAATGGTAATTGCA ATTGGTACTTGGCACTATCATGGAGTATCATTATGTCATCATTGTGTTAC TTTCATTTCATTGGTCAAACGTGAATGGACAAAATAACCAAGTTAATTTC CTAGATTTATTGAAAGATGATGCCAAAACTTTTCAACAAGAATTGACAAA ACTCGTCAATGAGAACCTTGGTCATGAAACTTTGCAGGTATAAATGTAAT TTACAGTGGCGGTGAAAGGGTGTTTGTGGGCGCTTCAAAATCCTTTAAGG GTACCAGTGAAGAATATGATTTGAAATCGCATAAAAGAAATATATTTTAA AATGCTCATTCTTTGCAGGAGAGAAACTCATCATACACATTTTTTCTTTA TAAGAACAAACTATATAAGAACGTAAGGCTTCCATGGGTAAAATATCAAG AGCAAGTACACCCCTGTGTCACAAACCCACTGGGACCTCAGGCCCACTGG AAAATTTGGTCAAAATTTGGTCCCCGGTGGGAATAATCCTGGAATTTCAG CCCCACTCGGAAAATGACTTTGATTTCATCCCTATTCGGCATTCAATGTT TTAAAATATTGTACTCCAAAACTATCCCCACTGGATTTTTTAACATTGGA ACAATAGAATTTCTATCCCTATCAGGAATTCAATAGGAATGTTTATCCCC ACTGAGGAAAAAGGTTCCAGTGGGGCTGTGAGACAGGGGTGTGCAAGTTA AGCACATTTTAAGGCTTTGTAGTCTCTAAAACACCTGATTTTTTAGGAAG ATGGACTAAAATCCTCTCAATTTGGTTAAGATAAGATTATGTTAAGAACA TTTTAGGTTTAAAACTCAGAAAGTTAAGGCTTCAAAAAAATTTGGATGTC CTTTAATAAAGATATTTTATAGTCATTCTTTGCTATCTTCATATGTATGT TTTTTCAGCAAAACCTTAATGATATGTCTGAAGATGATGCAACTAGCTTT GATGACCAGGCCACCCTCGATAATGTAAGTCGACTCTCGTGTTATATCGT CCGTAACCTAAATCCATTCGCTTCAAGTATGTAGTTTTCCTTCCCCCCAT TTTGAAACCAGAGTCGACTTAAGTCGACTTGAAATGACATTGAAACTGTG CCTTTTTAATTTATTTCGTGTATCTGTTGCATGCTACCCTATTCAATTTA CAAGGGAAAAAATGCACAAATATGTGAAGATTTCCTTCGAGGTTGAATAA AATGATTCAATTGACTTCCAAATTCAACAAAAACTCTTTTCTATTGCTGC TGCCTTTTTGTAAAACCTATATCTCAATTCGCAAAAGTGTTCAACCATAA AAAGTTGATGACTGCAGTGACGTAGAAAAAAATCATGTACGAAAAACACG AATTCTATGAAATAGGGTATTGAAAATATGAAAAGGAGATTATCGACCCG AAATTTATAGAATCAAATTATTGTCTCACGAATTTCAGTTTGTCAAAGAC CTTGCGGGAAAGACGACCATAGCCGAAAACGTATTGAACGAAATGTCGAG TCACATTTTGGACGATTATAAAACGAACAACGGTGATCAAAGACCCATCG AAAGTTGTTGTCAATTTGATGATTCAAAACTGGGATTTGTTTCAGTCTTT GGTGAAAACGTATTCAGATAATTTTCATTTAACTTTTCATAAAAGTTTTA GATTTTTTGATTTTTTTTGAAGATAGGCCCCCAAGCGGTTTGCATGATGT CATGATAGGGACTTTTTTCTAGCGTGATTACGTGATTTGGAATTTTTTTT CATGATAGCGTGATCAGAGGTCAAAGCGTGATCGTGATTTGATTGAAAAT TTTTTGTGCCTTTATATGAGATTTGGACTATTTCAAAGGGATGTGTGATT ATCTAATATTTTTTGCTGATTTGCTCGATCGTAATAGACGATATCGCGTT TAGATAAATGCAATGCATTCTGGTTTCTCGGGGACCCTGAAGGGAATTAT AATCTATTCCAGATCATTATATAATCGACATTATAATTTCTTTGAGAGTC CCCGAGAAACCAGAATGCATTGCATTTATTTAAACGCGATATCGTCTATT GAAAACAAAAGTTTGCGTGATATCGTGATGGGAATCGTGATCAGTGTTAC CACTGGGGGGCGGGGGCTCTTTGAAGAATATGAGAATTTTCCTTTTGCAC TCCTCCACATCTATTATTTCTTGCTTGGTGTCATTTATTGCTAAAAGAAA TCCCTTTCTTGACAGGTTTCGATGAGCGACATTTGTGAGCAAACACCTCC AAGCAATTCGAAAGTCTGTCCCTCTCTTGGAAGTCCTCCATCAGAATCCA TTCACTACCTAAAGAAAGAGGATTTGGTCACGAAATGCAAGGATGTTTAT AAAGAAGCCAAAGGCGAAGCAAGGAACATTCAATACGACTCTTTAGATGG TTATTCGTTCACTTATCCTGCTTATCAAGATCCTTCACCAATGGAATGCA CATGCGCACAAAGGGATCCCAGATTCAGGTTTGATAATCTTTTTTTTCAA CTCAATTTTAAGCCATACAACGTGTTTTTGTAATGGTATAGTGAAGTCTC TATAACTCAAACACTCGCCAGAGAACACAAGTTTGTTCAAGCGAAGTGGT GCAGTGGTAGAGCATCCTGCTACGGTACGCAAAGTTGTGGGTTCAACCTC TAGCGGGGTCATACCAAAGATTTCCAAAATGGTACTTGATGTTTCTCTGC TTGATGCTCAGTAATTAAGAGAAGGAGCGAGGGTAAGTGGAGTAACCCAG GGAGAAAGAGTGGCACCCTCCCCTACCTTCGGGTAGATAGCTATCGAAAG AGGAGCCTTTGGATCGCCTACGACTGCGATCGCAGCCTTACTTTCTTGTT CGAGTTAAAGAGACATTTGAATTATAGAGGTTCGATTTATTATGAAAACT CAACTATAGTAAAAATAAAGGCTCAGATTTCGAAAAACACGGATTTAAAG ACGCTTTAAAAACTCTTAGATGAATAAAGAAGATCTTTGGGATATCTTCG AAGTCGCTCAGACAAAGCTCGGTAAAAGAATCGGTACATTTTTTTTTCAA ATCATTTTCTTCATACAGTTCGCGATTGGCAGAAACTTTAGCAGGTAACA AAGGTAGACATTTTTTGATTGTTCTCGATTACTCAGAGAAAATTCAAAAC ACCATTGCCATCATGAGGAAAGTTGCAACGACATTGCTTAAACTGGTTAC TTCCAAAGATATGGTATGATACATTATTTATTTAATGTCAGGGATTTTTC AATTTTTCAAAGTACCTCATTACACGAATACTAGGTAAGTATTGAAATTT GGACGATCTGAAATAAACTTTTTCAAGGAAACATCGGCTGGTTTTAATCA AGGGGGTTTTTATTAATACGAAATTTTTCAATTCGTGTTAATAAAATGAC TAGTTATATTCGTGTAATAAGGTAGCTTTGAATACACCTTTTTTATAAGT TTTTAGAGCCTGGAAATATTTTTGAGATGTTCTTATTTACAGNGGCGCTA ACCACCTTAGTCATTATATTTTTGCTGGCCCCCTCACTTTCAAAATCGTG GCTCGGGCCCTGGATACAAGAGTGGGGGGAGATATCCCTGACTCTGTGGT GTGGTTGCTAATACTTGTCAGGTTCGACCATGTGAGGATACACTGTCCTC CTGAGCTGTTCGAGTATAGTAACTATACGCCAGCAGCTCTGTGTGTCGCG AGCACGATTCAGGTAAGCGCAGTGATTTTTCCATCCTAGAATAGTAAATG CTACCTTTGATAAGGTCTGTTGCGTTCATCAGAAGGACTATATCCTATCC ACAAAAAGGAAGTCACTGTTCAACCCCGGGGGTAATAATGTCCCCTTTTC TTTACCCCCTAACTAGACAGTCCTTTGGGTGAGTGAGACAGGAGTGTGCA CTACATACTATAATTTTCTTCATACAGTTCACGATTGGCAGAAACTTTAG CAGGCAACGAAGGCAGACATTTTGTGATTGTGCTCGATTATTCCGAGAAA ATTCAAAACACAATTGACATCATGAGGAAAGTTGCAACGACATTGTTTAA ACTTTTTACATCCAAAGATATGGTAAATTGCTAAATGCTAATTTTGTTGA ATTTCACAATGACTAATTTCAAAACATTCATTCATATGCCATTCATATAT TCCTGATTATAAAAAAAATTCTGGCGTTACCATTCCGGCGGTTTCAGAAG TTTTTCTGTCAACGCCCCTGTGTCACAGACCCGCTAGGACCCCAGCTCTG TCCCCGGTGGGAAAATACCCTGTAATTTCAGCCTCTCTTGGAAATCGACT TTGATTTGATCTCCATTCGAAATTCAAATCAAATTGCACTCCAAAACCAT CCCCACCTTGGAACAATAGAATTTTTATCTCCACATTGGGATTTCAATAG GAATTTTTATCCCCACTGAAGGAAAAAGCTCCACTGGGCGTCTGTCAGTT TTCTTTCATTTTCTCTTATCATCACTGTGTACCAAGTTTCAAGTATCAGT CAGAAAAAATATCAGTCAAATCGAACAATTCAAACAGTTAATTTACGGTT TTGGTCAAGTTTACATTCTGGTCTGTAAAATGCCAACCACATAGATGGCT GAACCAAAATTTTGTCAATTATCCATATCTACTTCAAGATCATGGCACTT TTCAACCTTCTTTAAGACTGAGATTTTAAGGGAGTGTTACTAATAATATT ACCATATAGCCAGGCCACTAAAGTCTATCGAATCAGCCATAAGTAGACAT TGCGCTAAATCTGACCCTGAGATATTTCCACAAGGAATGTTGCCATAGAT TCTGCCCATTTTCATCTTTATAGATTTCAGTGAAATTTTATCACGAGGAT AATTTGGTACCAGCGGACAAAACAGCAGATTGTTTGAAAATTTCATCACA AGCTACTCCTTATATCAAAGATAAAATTCTCGGAGAGATTGAGACTAAAC AGCCAAAAGGTAAGGAAAATAATTATTGATGAACTGGCTTGTGGCAGCCA AGCGTTCATAGCTTCGTTACTTTTTGATCCTTCGATGTCGGCTCTTCCTA TCATCGTGAAGCAGAAAATATTGTAAACTTATTTTCAAGGGAAATGTGCT CTCAAGTATCTAAAGGATGGGTGATCTGCTAAATGTGAAATGCTAAAAAA AAAGTCTTTAGCTGAAGACTGGAGTTAGAATGGATGTGATTTGGTTGGAA AGGAATTTTCAAAACAAATAATAGGATAAGTTATTTTCAAAAACCTCTTC TACTCTGACACCACTAATACAAAATTTCTTATCCTTGCAGGAGACGCAGC AAGCTATTCCAAGGTTTTCCGCGAATCTTTTACTGCTCTCAAGAATGATA ACAGCAATCAAACTGGTAGGTGAATTAGTATATGGTCTTCAAGACTAACT GATGTAAAACTTTTTTCTAAAATTGAAGGTTCTTAATAAATTCTTCGCAT GTGCTGGTTTGATCTTTTTTAGAGAAACATTTCATCTTTGTCACAAGTGG TCATTACATTGATAATTGGTCAGAGATTGACCAAGTCTTCAAAGAAAGGA GAAAAACGAATTCAGAATGCAATGATATGTACTTTTCGTTGTTATTAATA AATGGTAAGTCACTTTAAATCAGGCACATGCGCAGTAGTTTCGCTCAATA TTTTTTGGTACAATTACTTTGACAGGTAAAGCTGGAACTCACCACAAATC ATCTTTGGACAAAACAAGAATTTGAGAATCTGATTTACGCTGTCAATTCG GCAAAACTAGTTTTCGTCAAAATCTAAAATTTGGTCACTTAAATTAGGCT TTCACCAAATTTAGCTTTTTAAGTATTTTTGCTACTCACCAAAATTAGTT TACAAAGGACACCCAAACAACTAAAGTTCCATATTACCATTTTCCAAAAT CAAGCTATATACTTTATGATTTTTCTGTGACTTTGTTCGCCTATTATTTA TTTTATAATTTTAAAATATAATTTTAGATGGCAAACTACCAAAAGCTAAT TTCGTCAAAAATAAGAACCTCAAAGAGGGTTGTAATGTAAGTCATGTTTA AATCTGGATCTGGAAGTTTGTGATCTAATTCTTTCTTAAATCAAATTCTA TTGTCTAGAAATAATACTCCAATTCTTGCACCTGAGTAGATCAAGTCAGT CCCAGTTAAAGGCATTCACCTTGCAATCCAAGCTAGGGTTATTAATTTAT CATTGGTTCAAGTCACCACAAGTTTAGCTAAAAATCTCGATGTTGCAATC AAATAAGATAGGGTTCCCGGCAAACTCTACTAACCTAATAAAGTTTTATT TTCTATAGGACAATTTTATTGATTTTGAGCTTAGTGGAGACAACAATCAT TTTACAATCAATTCCAAGATATCTGAAATTCTACCCTCTGGAAGAAATAT CGACGATAAAGTTTATTACATCATGCCTATATCTGATCGATTTGGTAGAG GTATTTACAATAGAATCTAGTGTTGACCAGTAGCGTGTTGGTAGGGGGTC AGGGGCAGTGGCGTGGTGGGAAAATTTCTCTGGGGTGGCCAAGGCAAATA TGGCGCCCTTTTTAAAGATTTTTTGTTTTTGGCGCCCCTCTACGCTCATT ATGAACACAAAAAAGGGAGTGTGTGAGCGAAGCGAGCCAGAAAATTTTGA GTTTTTGAGGTAATGAGGGCGCCATTTTTGTTTTCTCTGTCAATCTTTCT ATATGGGCGCCTGAAAAATCCTTCTTGGCGTCCCTTATTTTTGGGCGCCC CTTCTCAAAAGGGCTCCGCTGGGGGGGGGGGGGCCCGGCCCCCCCCGCCC CCCCCCCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTTATTTTTGGGCGCC CCTTCTCAAAAGGGCTCCGCTGGGGGGGCCTGGCCCCCCTGGCCCCCCCT GCCACCACGCCACTGGTCAGGGGGCTGTTTGTTCAGGGGTTGGCAAAAGA CAAGGGGTGCAAAAGTCGCCTCTGATTACTAATTTCGTTACCCCTTTACC TTTTCACACCTAGGAACTAGCAGTTTCAGGTAAAGATATAAAAAAAGTCA AACATTTTCGTACACGCTTCGCTCGTGTGTATTTACTTACGTATTTTACA ACGATATTTACTTTTGATAGGGGAAGCCAAAATCACAACTTTGGAAATTG CCTCCTCAATTATGCTCAATTTTAGTCGACCCACCACGATACTGGTGCTA CCCCCCCCCTCTCCTAGTGTATATTGTACTATAACTTCCTTTCCGGTTCT AACGTTGGACTTTTTCAGAAGAAAACAGTATACCCCTGTTGTGGAAGTCC AAATTCCCACCGAATTCTAGCTGGAATTAATTCAATTCCAATTTGTTCCA ACTTTAGGCACAACGATTGATGCATGTAAAGCAGTGGTGGATAAAAGTTC ATCTTCACAAAATCCAATGAAAGGAGTTGTTTGTCTTTCTTTCTTGACCA ATGAATTTATTCGCGAAGAATGGAGTCAAACGGAAAATTCTTATTGGTTC CTTATAAAGAGAAACGGTGAGATTGACATGAGAAAAAAAAGAAGAAAAAA AAGAGAAATGAGATTGACATGCAGTCCCGAAAAAAGGATTCAATAAATTT TGTCAACTAATCTAGACTCGATGTCTAAATTTAGTTATACCCATATTTAG TTATAAAGCTTACTTGAAGTTCAGATTCCTTCTTTNGTAGACAAAATTGT TTACATTAAAAAGATATGCCAGTTATCTTGCAGTTGTAACAGCAATATCG TGTAGAAGGATGGGAAGTCATGACGTAACGTGGTAACAGTAGCAGTAAAC GAGGTAACATTGCGTTGTCAAGGTAAACGAATCCTCATTCATAAAAAGCT TAAAGGAAAAATAAGAAACATGAAATTAGATGATATGGCGGTCATCGAAA AAATGCGTTCTCTGTTCGCGTCGCAACGGGTGTTAAAAATTCATGCGGGC AGACGGGCGGTCGAAAACATTCCCGGGTTTTTTTTAATCACGCCAATAAC TCAGGGGCGGGTGGTAACGCGAGCAAAACAATTNGACTAAATTTTGTCAA CTAATCTAAACTCGATGTCTAAATTTAGTTATACCCATATTTAGTTACTA GCCATAGCTTTCACTAACTGACACCCGCTAGTACAAATGCTTGTAAAAAC TAATTAATGCTAATTAAGGCTTTTTAATGCTTTATAGCAAAAGTTTGGAA TGATTTGGAATAGTTAGAATGATTCTTCTCAGCATTTTCTTTGAGATATC AATGAATAAGCTAACATAAACGAAACATATTTTTTTTTCTAAAAATGTGA ATTACTTTTTACAAAGAATAAAATACGAATCTTAAAACATTAATTAGGAA AAGTGTCCAGGTATAATCAATTACAGACAGTTACAGATACTAAACCAGTC AAAAGACATGCAACTATTATTTATTTCAACCAATTTGAAATATAAATGAA ACATAGTAGAACCAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGAAAAAGTTTTTAGGCTA GCAACTGCCGTCCCGGAAAAAAACCGAACATTTACGGAAGAGACTAACTA CGGGTAGGCTTGCGCGACAAAACAAAACAAAACACGCAAAGATTCGAGAT TCCAGTCCAATATCTATGCGTGAAACTATGAGTGCCTCCTCGTCGCTGCG CTCCTGTGGGGGCAATGAAACTATGAGTGCCTCCTCGTCGCTGCGCTCCT GTGGGGGCAATAAAGCTTACTTGAAGTTCAGATTCCTTCTTTTTTTTATT CACACGATTCTAAATTTTTTTTTCTCGAATTTTTTACTTTTTATTTCTAC ACAGGCCAAACATTCATACACCCGAAATTCGGACAACCACTTGGATCAGA TGAACTTTCTCGGACAGTTAGTATTTTACAAACCGAATCTTCACAAAGTT TCAAAGATGAAGTTTACAATAATATGATAAGGTAAACCTTTCTTTTAAGA CTCTTTTTTGTATTTTATTTATCCATGACATAATCATCATATCGCCACAA ATTTAATTTGGTCGTAGAATATTAAAAAATAACCGTATGAGAGCGATGTT TGATTAAAAAGACTATTTATATGGGGGGATTCGAAATCTACCAATTTACC AGAAAATATCTTGAGATCTAAATCGTATTGCTCTACCACTAGCGGCGTTC CCGGGTCAAAGACATTATCACACGTAATGAAACCAATATCTCGAGGGCCT TTTGGAGCAACCTCACAAAACAAAACATTGACTTATACTTGGAAAGCTGT TCCAAAGTCTGACTTCATTATGACCATTGTGACGTCATCTGATTACGAAA AGTCCGAACTCAAAATCACCAATCAAGGAGGGAAAGAAAATTACCATCGC ATTGACTTGATTCCAGATAATTACGCGAATGATTTGTGCAAATACAGTAG TGAACATGTTGCTACAAAAGGTACTTCTTTTTTCCTGCCGCTGTTGGCAT ATGCCGACAAAATCATTTTCGATTTCTTTGCCGGTATCGGCATTTGCCGA CAAGAGTGATCTGGACCTGTTGCCAGTAGACTCTCTCTAGCTCGGAAAAT CTAAATCTTAAAAATCTAAAAATCAAGGCTCTAATTTACTTTTAGAATAT AGAGTTTTAACATTAGACTTAAAACCTTACGACCTTAGGTTCCCAGGATC CCCAAAAGTTCAGAAATTGTTCACATGAGGCTTAGATCATAGCTTAGGAA CCATCGAATCCCTCTAAAATTGAAATATCAAATGAAATAAAGTGAAGTTA CTGAAATCGAAATTCTCGCATGAACTTTAAGTTCTGTAGAAAACTATCAC TATATTTTGAACTTTCAATGTAGCTATAATTTCTACTCTTTTTCAAATTT TATTTATTTTATTTATGTGGAACGACATCAAATTTCTTCCAAAGTTTCAT CAAAAGGGTCTCTAGAGAATCGATGACAAGGTTCTATGAAAAATTGACTT TTAATGTGTTAGAAAGATGATTTCGAAAGAGGGTTGTTCTCCCAAATGTT TAAATAGAGAGTTTATGTATTTGTGTTTTTCTGCGAGGGAGATGGTTAGC TTCTGATTTGACTAGCTCCTGATCAATTTATTTTTGATTTATTTTTGATT TATTTTTGATTTATTTTTGATTTATTTTTGATTTATTTTTGATTTATTTT TGATTCATTTTTGATTTATTTTTGATTTATTTATGATTTATTTATGATTT ATTTTTGATTTATTTTTGATTTATTTTTGATTTATTTTTGATTTATTTAT GATTTATTTATGATTTATTTTTGATTTATTTATGGTTTATTTTTGATTTA TTTATGATTTATTTCTGATTTATTTTTGATTTATTTTTGATTTATAAAAT TGTGTACGAGATTTATTTCAGTGATCCTCGATTTTTTCGGGTCAGAACTT CAGTCACTCTGCCGTCCTCAAAAGTGTAAATACATAAACTCGCTGATATT TGAGTGAATGGTATTTACACTTTTGAGGACGACAGAGTGACTGAAGTTCT GACCCGCAAAAATCGAGGACAGTAAAAGAATGTAAACTAGCTGATACTTG AGTGAATGACATGAATATGAAACTCTCATTTTTTCCAGATCTTTCGGTTA TCAAATTCCCAGCAGATGCTTTTCAACGACCAAGTTTTTACTTCAAACTT GAAACTAATGAAACTGTAAAAGAATTGAATGATTTGTTTACACCTGGGAA CACGGCAACCCCTCCTGATGAATTGTTCAAGGTTTGATAACATATATTTT CTTTATTCGCACCTGAAGGGGATTAATTTTCGCAAGAAAAAATCTTAGTA CTCGCGAAAATTTTGATAACACTGCTTTTAGAAAAATGAAAGAAATTAGT TGAAAAAGGGGGAGATTCGCGAAAATAAATGAAACTATTTTTGAAATAAT GGTCTCACGAAATATGCGCTCGCGAAAGTTTAAGGTCATAAATGTTTGAT TCATCATTTTTTCAATACGGGCTTTGCCTTTTTTCAACCCCGGCTCCCGG GAGCTGGCAGGCTCTGAAAAACCTTTTTTCATTTCTGTTGACTATGTCTT AAATTATAATGTTTTACAACTTTTTTTTCGACAGGACATGGATGTGTTCA ACCATCTTCGTCAGTCAGTGCAAGCTACACATTTGATGGAGGGATATTGG AAAAATGACACATCTGAAGCTGCAAAGAACACGTTAACAAGGTTCTTATA TTTGATATAGTGACCAGGTAGCTCAGTCAGTAAAGTATTCGACTCACAAT CCAAGAGTTGTGGGTTCGATTCCCGGTCCACCAACTCAGTGAATGAGTAG CTTAGATTGGGTAATCCGATCTAAGCGGAAAGTTGCTGAGAGATGAATAT AGGTGTTTTACCTCAGCATTCAATTTCCCGGGTGTAGCCCAAATAGAAAA GGGAAAAGACTTCCTCACTCCCGGCTCTGCCGGCAGCCACCAGATGAATA TACTTATTTACTCTATTTGATTTATATGATATAATTTAGTCGTAAGTGAC AAGGCGAGATTACATTGAAATTCCACTGAGTTATACATTTTCGAGATAGG GGTATAAACGGGAAATCTTTGGCTTTGGGTCCTATCATTGTAACGTTCAA TGGCCAAAAATTTAGCTGTTTATACCCGTCATTTTCACCTCTAGATACAT TGGTATGCATAATGGCTTCTTTCGAACGTTTCCTGGACATTTGATGAATC CTTCATACGATCCAAGAGCTCGACCATGGTGACAAATTTACTCTTTATTC AGCTTAGTCTCAATCAAATCGAACTTAGTTTTATAGATGGAAATGAGTTT ATATTTAATGTGGAAAGCTAAGTCATCTTGTAGATTGCGTCTCTTGATTG CCAACTGGATCAGCTATTTTTCCCTATATGGGGTGGGGATTTGTTTAAGG AAACCCTCGTTTGTGACGCTGTTGTCTTACAGCTCAGCCAGCAAAAAAAG AAACAAGAAAAAACTTAATTTGATCATCAACCCCTGTAAATCAAGGTCTT TCTAACTGCGTATCTTTAAATGATATTCTATTCATCTAGGTATCGATTGA TGATTGCACAAAAAGGAATAACTTTAACAACACCCTATCCAGATGCCTTT ACCGGTGAAATTGTCATGACGCTAGGGAAAGTTCTACTGAAGTAAGCAAT ATCATTCAAGGTTTGCTCCAATTCCTCTAGAACTTATAATTGTGCTAATT TCACTTAAATGTTCGAGTTGAACACAATTCTCAATCAAAGGTCATCAAAA CATGCAATAAATTTTTTGTATCATTACGTCAGTTTTCTCACATCAATAAG TTTGAATCAATCTTTGCCAATGATCTCTATATGACGTTTTCAAGCTTCAA GCTATTTGACCAAGACTTTATTTAACACAATCACTTTATCTTTACTTCTG ATGTTAAAGAGGAAAGAAGTCAGTAGAAAAAGCAGGGAACATTGCTATGG ATTTCAAACCACTCTACTTCAAAGAGTTACTAGAAAGATCGATCAAAGAG TGTGCATCTGGGTAAGTGCTGGCTTAGTATTTTTATTCACTTTTTGATCA TTATAAAGTCAAATATCCTTAGCTATTCTCTGTGGCCGTGGTGCAAAGTT AGACCATCCGGATACGGTATGCAAGGACGTCGAGAGTAAGAGTAAATTCT ATCGTGGGTTCAATCCCCAGCCGGGTCCTACCAAAGACTTCGTACTTGAC TTGCAGTTCAGCAATTAAGAGAAAGATCAAGGGTAATTAGAGCAATCCAG GAAGAAAGAGTGGTGCCCTCCTTTACCTTCGAGTAGACAGATATTATGAA AAGGGAGCCTTCGGGTTGCCTCGACTGCGGTCGCAGGCTTACTTACTTAT CCTATTTAGCTCACGACCAAACTTTACCAATGATAACGGTGGACATAAAC TTGCTCTTTTTCCAAGAAATCTATCCTAAGCAACCTGGCAGCATCTCAAA GTAAACTCAATTTAGAGACAACCGTTTAAGTTTTTCAGACTTGAGAACTT TAATATTTCTTTTACAGAGCATGTGTTGTGATTGATCGAAACGGCTTCGT AGTTTATCAATCGAGTTTTATGGAAGAGAATGAAAATTCAACCCTCGAAA ATCAACACATCGTGAAGATGGTAAGTCACAGAAAGAATTGCTTGTTTAAA CCTTAACAATGCCTACATAAAACAAAAGGTTTTGAAAGGGACTTATTTTG CGAAAAAAATTTCTAATATTAGTACTATCGTTCAACTATCTTAACATTAA AAACCATCGAGCTACCAGGTGGGGTACTAGTGTTGGCGGATGAGGGGTAT GTGTTGGCGGGACCTCCGAAAACCGACCCTTAGAATGATTTTTACTGAAA AGTTGACCCTTAGAGAGACTTTTTTGAAAAATTTTCTTCCACTTTTGAAA AAAGTCCTACCCTTAGAGAGACTTTTTTACAATTTTTTCTCTCAAAACCA AAAAAATTTCCTAGAAATTGTGAATTTTCATACCCTTAGAGAGACTGATT TTTCCGACCCTTAGAGGACTTTGAATATTGAAAAAACCGACTCTTACCTG GGACTCGTGGAGGTGAAAAAAGGTACCTTTACCAGCGACTCTAAATACTC TTAACTCCACGGAAAGGTAGTACCCTAGCCTCAACGTTCAACGGGGCCAT TATCTCCTTCCTCTTGGACGATGAAGAGGGAAAAAATCATGAATTTGTAA ATTAGATTATTTTATGAACTGTATATGGTATGTACACCAGAAAGCGTCAA GAAAAATAAGAATTGTTTCATGAATTTTCCCGGGGGGAGGAGATATTTGG GCAAAAGCAGTGCGGGGATGTGTCGCTGGTTAAGGTACCTTTTTTCGCCT CCATTAGTCCCAGGTAGGGTTGCAAAAACACCGAAATAGACAAATCAGTC CCTCGTAGGGTACCTTTTTGGGGGAAATTGGAAAAATATAGAAATTTTTG AGAGCATTTTGGAATTTCAGTCCCATTCAGGGTCACTTTTTCATAAAAAC GAGTTCCACGTAGGGTCCATTTCTCGAACTTCAGCGGCACAACCCCGTCG GTTAGGCCAAAAAATTAAGAAAATGCTTAAGAATATCACCATCATGAAAT TTGGCAACATAACCTAAGAATGCCATTTTTAGAGTATATTTAACTGTAAA TTTCCAGTTTCACAAAAATGTCATTTAATTAATCGGAATTGTATTCGTGC TCAATTTAGGTAGATTTTTTATCCTAACCTAAGAATACCGAAAAAAGTTA AGAACATCCATGATGAAATGGAAATCCATTGCATTATTATAAAAATAGTG TATATTTCTGGAGAATATCTCCGAAGAAATGTACCATCAGGAATAATTTT CTGAGAGGTTATCGTCCAGAGGGGCATGTCTGCAGGAATGATTTTTTTGT CCAATCTTAAGACAGTAATTTTTTCATTTTAGCATGGTAGACTCGCAAAG ACGATGATTGAGAATGGAGTTATGATAAAAAATTATTGTTTGGAATTCCG AAACAATGTAACCGTAAAAGAATGGTTTTACTCTGTAAGTTTCAAAAACC AACTCAATTAAGAAAATCGTCTACTTAAGTTTAGCTTTATGATTAAAATA TGATTTCTGATTTCTACGTACCGCGCTCTACCTAAAGAGATATTGTGAAT GTGACGATCTGACCTGGTTGTTCAACCAAAACATTCGAAACCGCGTTTGC CTTTTACTTGGAAATGCATGCGAACAGGAAAGCGACTGGGTACTTATGTA TATTGTTTATGTATTTGATTGACAGTTGATTTTGGTGCGATGGTTTTGCT TTAGCCAATCACTGTGCTGAAAAGCTCATTTAAAATCGAAATCTGAATGA AAAAGATCAAATCCGTGCGACAACCTGAGCAGATTATCTTACGGAGCGAT GGCCTTTAGAGTGAATGCGTGCCATGCGTGGAGTATCAGAATCTGCTCGG AGATTAGTTGTAATCTATTTATCACTTTTCTTCATCTTTTTCAGCTTGAC CACGTGATAGAAGCGAAATCGTATAGCAAGGGGTGTTTGAAGGATTATCA TGTTGTGCCGATTATCGATTCCAATCTTTTATTGTTGTATATTAATGATC GATGTGATGTTAAAGAGAAATGTACTTGCAGAGAACCGATAAACGGGGTA ATTGTCAATGTCGAACAAAATATCACATATGTTTTAGTATGGGAAGCAGT TTGTGATTTACATTCTTTCAAACAACATTCATTTTCAATTAATTTCCGCC GGGGAAAAATCAATTTTTCGGTTTAACATTTAAAGTCTAAAACTTGCGGC GATCTCCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCCCCCCCC GAGGGTATTTAACCAGGTTGGTCAATGTGTTTAGATTGCAGTAAAATTTC TGTAAATAATCTTTTCCATTATCTTTATTAAGGATTCTGCATTTTTTGTA TGTCTGAAATAATTATGTTGAGTAATATTAGATGATTTGTGGTAGAATAA AAAGGTTTTTCAACCTATGTAGACGAAAACCTGGCAAAGTCCAAGAACTT ATTTTTATGGATTGGTGAAATGAGTAGCTCGTGTAACAAGGAGCTTTCAA CTAATGATTATAGTAGGGTTGAAAGCGTCAAAGGGGTTGCCTTGGTAACT CAAACTTCCATCTCTGTATTTTCTTTAAGAAACATTTTTCCTTAGATAAT GAGTATCTCAATCAAGAAGTCAATGTTGCTTGCCAATATAAAGAATGGCT GAAAGAAGTATTTGTGGAATTTGATAATCATTCATTTTCTATTCTTAGAA ATTAAGAAAGGGAACTCATTTAGTAGTTTAGTGATTAAAGTATGATGGTA TTAAGGTACCAGCAGTTTGGAGTTCGGTTTGCATTCGAGTAAGTATGAAG CAGTAGTCTTTTTTTTAATTACTTTTGGTGTTGAAAATGAATAGATAAAC CAAAAAAGTCAAGGTTCCTAAATTAGCAATTTGGTACCGATAGTTACTTG TTTACCTTTTTACTGACCGACGCGCAACATATTACGTTTTATAATATACA ACTATGTTATATCATAATATCATAATAATATATTACAAACGGACGATAGC CTCGTCTTGCTCCACTTTTTACTGGTACCGTAGCAGAATAGAAGAACACG AACCAAGGGGTTTGGGTACAAGCTTGAAAAATGAGGTGAAAGTTTATTTA CACCCCTGTCTCCCAGCACTGGTGGAACTTTTTCTAACAGTGAAGGATAA ATATTTCCATCTATTGTATTCTATTCTATTAAATTTCGAATGGGGATGAA ATCAAAGTCAATTTTCCATAGGGGGTTGAAATTTAGGGTATTTTTCCTAA CGGGAACGAAATTTCGGCCAAATTTTCTAGTTGGGCTTGGGTTCCGGTGG GTCTACAGAGTTATTAGTTTAATGATGACGTCTGTTATTTTTACGTTTCC AATGGGGTTTAGTATCATAGAAAAGTTCTCCATCTTGATTTCTAAACAAA GCTACTATCATTCGAGATCATCGTTTCTCAAAGGTGGGGACGATTTCGTT GTAGTATGAGAATATCAAACTGTAAGATCATATCATAGGCCCCATGGAGC CGTTTGAAGTAAGATGGCCAAACTTTTGAGATCAGGGTTGAGCGACGAAG AAATCTTTCACTTTTACGACTTCTCAACACCATTTTCCTAAGAATTCAGG TGTTTTAGAGTCCGCAAAATATTCTTCACTTGTTCTTAATTTTTGGCCAT CAAAACCTTTTGTTCTTATATAGTTTATTCTTATAAAAAACGTACATCTA ATCTGACAAAAAGATTTTTTGACTTTTTTTTGAAGGGAAGAAATACTAAT CAATTAAACTTATTTGTTTATTTTTAGTCAAAAATGTCAACGTGTAATGA CCCTTTAATATGCTTGTTTTAATTTCTAAAATATTTGGCCATACATTTAA AGAATAATTGACATCATTATGAATATTCAACTTGCCTTGATAATAACATA TATGAAAGTTGTAAAAATCATGTAGAGATAAAATAATAAGCGAGACTTAA AAGGGATTTTAAAGTTGTTGTTTTTTCACATAGCTATCCTAGTCTTTTGT TTTCTCAACTTATTACCTTTAGGGTTTTATTTAGCTAAAGCATCAGAACC TGAAAGTACGAATAAACGAATTGATTTAAGTCCAATTGGTCTCATTTTTC CAGCTGAGATAATCTTTTTGAGCCTATTATAGCCTGTTTAAAGACAATTT CAAAAAGGCTTTTTACTTTCAGTGATTGAGTTTATATTCTCTAAGACTTT ATTAATTCCTTGGAGGATTGGGGAAACTCAGATCGACTTTACAAAAGATA ATATTCATCAGTAATAATCATCGTTGTTGCGATTTTATTTTGATTTAGAG GATGGTCTTTTAGGAGGACTGGACATAATGTAATACAGTTGACACTCTCT AATTTGATTTTCGTAGGGAATTGATTTTCATCAAATAAGGGAGCATATCA AATAGTAGAGCGTTGTTTATGAGAGTTTATCGTTGACAGTGGCTTTCAAT ATTATCGAATAATGGAGTCTATCGAATAATAGAGCGTCTAATAAGAGAGC GTCAACTGTAAAGGCCTACTTTGAGGCTAGAAATTATATCCATTTTACAA CACTTAATTACTAGGTTTTCTTATTGTTCTGACTGTTTCAAAGCATGCCA GCTTTGCAATGTCATTATTGACGCATTAAACAAATCGTTTCTGATTTATC CATGTTAAACCGCAAATCTTGAGAAAAGCTTCAGAAAATTGTTGATTGTT GTAATTATTGTAGAAAACTTCAGAGCTGTACCATTATGAATTACTACGTC ATCATTGTGTTATCTTTATTTCATTGGTCACACGTGGGTGGTGATCCTAT CTTAAATCGATTGAAAGATGGCTCCAAAGATTTTCAACAAGAATTGACAA AACTGGTCAATGAGAATCTTGGCTATAAAACTTTACAGGTATATATTGTC TTTAAAATTTAAGCTTCTACAAATTCAAATGACTGAGAAATAGGTCTTGT CACTTAGATTTGGGTAACTGACATATTGTTGAACCATAAACTTGTTCGTG TACTTGGTTAAAGAGATATTTGGGTTTATTCAAGGATTATTGGGCCATTT CATTTATATTCATACATGGGGATGGACAAACATTCCCAGGGAGGGGGAGC AGAATTTCCAGGGGTCTAAAAGAGTGTTTTCTCATTTTTCAAAATTTCCA AGAGGTAAAAGGCTGATTTTTGTTCGTCCACTGACCCTTTAAGATATAGA AAGAAGTTTCGCAAGGGTTTTTCGACTTGAAAAGGTTCGTCCACCCCGGT ATGGAAATTCAATGGAATGATCGATTATCGCTATATTATAGTCCTTGATC TCTTTCAAATTATAGGATAAATTCCATAAAATGTCTCAAAAAGAAGACCC CTTAACACTTGACGCACAACAAACTGTTGATGATGTGAGTATGGTATTTC GAAATTTTTGGCTTTGCTAACGTTATTTACTTTTGTTTGAGAAAGATTGC TCCTGTTATACGTATCTATCTATTAAGACCATGTTCTAGTGACCAAAATT ACAGCCCTATGTCACAGCCCCACTGGGAAGTTTGACAAAAATTTCGTCCC CGGTGGGAAAAATGCCCTAGAATTTCAGCCCTACTGAGAAATTGACTTTG ATTTTATTCCCATTCGAAATTCATTGTTTAGAAATTGCAACTCCAAAACC ATTCCCACTAGATTTCTTAACCTTGGAACAATACAATTTTTATCCCCACT GAGATTTCAATCGAAATTTTTATTCCCGCTGTAAGACTAGCCGTATTGTA TAAGGGTTGCGAAGCGATCCAGACTCCACCTCAATTCGCAAATTGCTAGC AAAATAAGAGACTCTCTAAAAATCCCTCTTCTAATAAAAGCGCTACAGGG TCGTAAGAGCCTTAATGCCCCAAACACACCACATAATCCACGGCGGCACA ACACCCGCCGCTGCCCGCGCATCGCTCTTTTGTTTTCCTTCTAGNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC TAGTTATTCTAGTGTAAATGGTGCCTTAATAAAATCGAACGATATTCGTC GAACGATCGAACATTTTTATTCGAATCACGAATCGTCTGTCGAAATCATC AGAAAACATAAAAGTAAAACAAAAACAAAAATGTACAAAGATGGCTTGTT GGTTCTTCAAATTCGACAAATTTGATTACCTCCGTACTTCTTTATCATAG AATATCCACTTGGTTTTGCAAGGTAAAGTTTCGTTCACTAAAAGAGCACT CCTCCCGCCCGCGCGACTTGCAAAAACTCTCATTGATTGACCTTATTTGA TACTTGATACTTGCTGTTAAAAGTCAAGGGATGACGAAGATCCTTTCCGT CACCGTTCAACTATTTTTTTTCCATTTTAACAGCAAAATAAACATTAAAA ACCGAAGAACCACTGCTTAGATTGCTTAGATGCGTGCCGCCCGCGCGGTA ATTTGATCAACTCCAGACAGTCAAGAACACCTTCAAATTAGCCTATCATA GGCTGATTAGCCTATCATAGGCTATTTAGACTATTTTATATAGGCTATTT AGCCGAAATCGATAAAAACCTCGATTTCTAACGAAATATAAATAGTCGCG TCTATTTTTCACCATTACTTCATTGCCCAAAGCCAAAAGAATCTTTTTCA CTTAAACTGATATGACATTCAATTTTGGAAACAGAAATATATAAATAAAT CTATTTTTATAGGCTAATTTTCTTATAATGAAGTGCCGTGTGCAAAAATA CATGTTTGTTTTTTCTTTTTTTTTTTTTTTAAAAAAATTTATTTTATCCA AGACTTTGAGCGAAAAACAGCAATAGCCGAAAACGTATTGAACAAAATGG CGAGTCACATTTTGGATGATTACAAAACGAAAAACGGTGATCAAAGACCC GTCGAAAGTTGTTGTCAGTTTGATGATTTAAAACTTGATTTTGATCCCAT TTTTGGTGAAAAGGTATCTCTTAACTTTGGGCTTGTTATTGATAAATTTA TTATGAATAATCCAGTCATTTTGATTCCAACCCAACATCACAACTGTAGA ACATGACCATACTAGCAGTAGCATGGTAACTTATCTTCTCCAATTTTGGC GCACCTTAGTAAAGATAGTAGCGAATTAAAAATACCTGGACGCGTTTTGC GTTTTTGGTAATTTCTTTATTTTTGGGGCACCAAAATTGGTGATTGGATG AAATCTCCGCGTTCTTTAACATCTCCAAATAACTGAGTTTATGTATATGT TTTTTTCTGCGACAGAGGCGGTAAGGTTCTAATTAATCTGCATCCTAACT GACTGAGAACGACGGGAAATCAACACTTTTATCCGTCCTCGATTTTTTAG CTTATAACTGGGGGTTTTTCCAAATCACTTGAGACACTTCACTGCCCTCA AAAATGCAAATACATAAACTCGCTAAAATCAATGCTAAGAGAATTATTGA CTNATTCTAAGTCCGTGTTTCGGCTTCCGGTAATTTTGTTGCTGTTCACT GCTAGGGTACACCATTTTAAAAAGGCATTTTTTGCAGTCCTAGCTATCAA ACCGAGAAAATTTGCGTGGCTTCAAGCCAAATCATTCAAGGTCATTTTGA TAAAATCATCGGTTGGAAGATGTGATTTATATAGCAAATTTTATAGCAAA TTTTCGCTTGGGATAGAAGTTAAAGGTACGTGCACAATATAGCAAAACTG CTTCGCTCATAAATTCGCTTCGCAAAAAGTTTCACCGGGGCTGTGAGACA GGGGTGTAAAATTGTTACAAATCCCAGCTGGCACACAACGTTTTTTCGAC GTTTATCTAACGTTCACAACGTCCATATAAGGTTAGGTGAACGTTGAAAT AACGTTGTGTGCCAGGAGATGAGATTAGCTCCAAACTTATTTACTGAATG ATTTAATTTTTTTTTTTTCAAATAATTTAGTTTATCCAAGACTTTGAGCG AAAAACAGCAATAGCCGAAAACGTATTGAACAAAATGGCGAGTCACATTT TGGATGATTACAAAACGAAAAACGGTGATCAAAGACCCGTCGAAAGTTGT TGTCAGTTTGATGATTTAAAACTTGATTTTGATCCCATTTTTGGTGAAAA GGTATCTCTTAACTTTGGGCTTGTTATTGATAAATTTATTATGAATAATC CAGTCATTTTGATTCCAACCCAACATCACAACTGTAGAACATGACCATAC TAGCAGTAGCATGGTAACTTATCTTCTCCAATTTTGGCGCACCTTAGTAA AGATAGTAGCGAATTAAAAATACCTGGACGCGTTTTGCGTTTTTGGTAAT TTCTTTATTTTTGGGGCACCAAAATTGGTGATTGGATGAAATCTCCGCGT TCTTTAACATCTCCAAATAACTGAGTTTATGTATATGTTTTTTTCTGCGA CAGAGGCGGTAAGGTTCTAATTAATCTGCATCCTAACTGACTGAGAACGA CGGGAAATCAACACTTTTATCCGTCCTCGATTTTTTAGCTTATAACTGGG GGTTTTTCCAAATCACTTGAGACACTTCACTGCCCTCAAAAATGCAAATA CATAAACTCGCTAAAATCAATGCTAAGAGAATTATTGACTGTCGCAACTT CACTATATACACCCTCCCCATATATCTAAACGATATTCCCAAAGGTTTCA ATGGAAGACATTTGCGAGCAAACACCTCCAAGCAATTCGAAAGTCTGTCC CTCTCTTGGAAGTCCTCCATCAGAATCCATTCACTACCTAAAGAAAGAGG ATTTGGTCACAAAATGCAAGGATGTTTATAAAGAAGCCAAAGGCGAAGCA AGGAACATTCAATACGACTCTTTAGACGGTTATTCGTTCACTTATCCTGC TTATCAAGATCCTTCACAAATGGAATGCACATGCGCACAAAGGGATCCCA GATTCAGGTTTGATAGTTTTTTTTTTCATGATGGTACAAAAAAAAGCAAA AGCTGTAAACGAACAGAATTGCTTACGTCAGCAAATATTTTTTAGTAACA GGAATACGTTAGTGGAGCCAGTAGCCTAAGTTCGATTGAGGTCCTATGGT ATAGTGATGTAACCACCAGGGATGTATTATAATAATTAAAAAAATTAATT AATTTATTAATTGATTTATCTTCAAGTTCGCGACTATTGGAAACGTTACC GGGAAGTGAAGGGAGACATTTTGTTATTATTCTGGATTATTCCGAAGAAA TTAAAGATACAATCTCAATTGTGAAGAAAGTTGCAAAGACATTGCTCAAC CTTGTCACATTTAAAGATGAGGTGATTTTCTTTCTTATGACTCAGGAGAC TTCTAAAACTTTAAAGACTAAGGGGGGGGGTACTTAGGCAAACTGGATGC GAGCCATAAGGGTCCCTTTTTCACACCCTCGAAACTCTTTCAAAGGGGTG CAAAAATCCTCCTCTCTCAAAGGGTCTTGATTTTCTAAAATTTGGATAAA AATCGATTGAAAATTGACAAAGATTTTGAAAAAAGTCCTCTCTAAGGGTC CCAAAACACAAATTTTTCCNACACCCTCGAAACTCTCTCAAAGGGGTGCA AAAATCCTCCTCTCTCAAAGGGTCTTGATTTTCTAAAATTTGGATAAAAA TCGATTGAAAATTGACAAAGATTTTGAAAAAAGTCTCTCTAAGGGTCCCA AAACACAAATTTTTCCTCTCTTTAAGGGTCGACATACCCGTCACCTTGCA AACCTAGTACCCCTCAGGCTAGTCGTCAAAGACCAATTGATTAAAATTTC CAACTCTATCGTTTATAGAAATCTTGTACCAAAGTCACTAACATCACCTT TTTATTTTACTGATTTTGGTAGGATCTGTGTTTAATTTTTCATCTTTATA GATTTCAGTAAAATTTTATCATGAGGATAATTTGGTACCATCGGACAATA AAGCAGATTGTTTGAAGATTTCATCAAAAGCAACTCCTTATCTCAAAGAT AAAATTCTCCAACAAATTGAAAACAAACAGCCAAAAGGTAGGAAAGAGAA GATCTTAACAAATTAAGGAAATCTGGTAAAATTAAATCTTTTTAGAAATA AGTTGTCCGGAAAACACCGACCAAATTTAAAAATGCGAAAAACTGACCAT AGTTTATAAAGGTCACTATATCTTCCCTGAAATCCCCTGGACATCAGGAA TCGCACTTAAAGCCACAGATTTTCTTAACCGAAGTTTTACTCTCTCATTT TTTCAAGGTGAAGCAGCTAGCTATAAGAAGATCTTTGAAGAAACTTTTCA GATACTATACAATGATAAGAATAATCAAACAGGTCAGTTATTAGACGATC CTCTCGTCTACATAAGGTCAAAAAGGTTATAGTTTAGAGGAGACGAGATA ATTTTGAAAAGCAGCGACAAGCACGTGGCAGATTAAGAAGTGGTAGAAGT GTTTACTGGTGTATTCTTTCCAAACTCTACCACCACTATTTTTCCCCGTA AACTTCCCTGACGCCCTGACGCCCTGACTTTGCACATATTTTGTTGGAAT CAATGTTGTTGAAAATTTCCAGGGTTTTTAATCCTTGGTTCTCTGTAGAT AAGAATAATTTTTGTCTCTATATCCCCTCGTCTCATTGATCGGTGAAAGA TGATTAGTAAGCGGGGATAAAAAAAGATTCTGGGGAATTTGCCTTCTAGG AAAACTTTATCCCTGGAAATTTTCATGTCACCGGAGATAAATTCTAAAGA AGGTTGAAAATGTATTTCTTCTAAAAGATCAATTAGGATTCTCAGAAAAT TTTCCCAGATGAAAGGGGAATTAAAGCTTCACAACAGAGATAAAAGTTTG CAGCTTTTGATATTTTTTGGATAACTTTCCCAGTGGGTAATAGGGTCTCA TCGGTTCTATGTTAGAGACAGACCAGGTACTTCGGAATTATTGAAATCTT TGTGAATACAACCATAATGAATGAGAGGTACTTCTCATCCTTTTTTTTCA GAAAAACATTTCATCTTTGTGACAAGTGGATACTACAAGGATGGCAGTTG GTCTGAAGTTGAGAAAGGGTTCAAAGATGGGCGGAAAAGTTTGGAATGTG GCGTTTCTTTTTCTCTTCTACTAATATATGGTAAGCTTTATAGGGCAGAG TAAATACACGCTTTTTTAGAAGAATGGTGTATATCCATTCCATCGTGGAT ATTCTTAACTTTTTTTGGGGAAATCGTCCTAAAATATTCTTACAGCATTC TTAGGTTAGGATCCAATTCAGACTAGCTTGAGTAGCAAAATTCCATGATG GTGATAATATTCTTAGTCTTGTATTCTTAGTCTTTTTAGCCATTTTCATC ATATTTCTTATAAAGTGTATTCTTATAAAAAAGCGTGTAGATACTATTTT CCTTCGTTACACTATGAACTATAAAATCAATAGTCACAGGAAAAAATTAG CAGATCACAAGTTTGTGAAACGTTGTTTCCGGCCCTTAAAAATCGGATTT TCAAAATTTAGTTTGTGAAATAAAGTTTGGGATATTGTGAACATTGGGTT TTATTATTTCACATTGAGACTTTCTTTTCACAAGGTCATCGTGAATTTGA TTTTCACAATGACAAAATTAATTTTCACAAGCTTAAGAAAAATAGGTTGT AAAATTCAATTTCACAAGTTTGTTAATTTTATATATCATAACTTGGGATA TTGATTGACAATCACAATGTAAAATAGTATTGGTAATAACCATTCTGATA CCAAGTTTGGGAAAGTCAATTTCCGACCCCAAAAACATTTTCTTTGGTCT GATTGGGATTTTGCAAATGCTGGGTATGTTTTATTCTTTGCTAAGGCAAA TTTGTGAATTTAGTATTTGCAATGTAAAAATTGTTTTCACAAGTTTCAAA AGTAAGCTTGTTAAATTCCATTTCACAAGGTTAAGTTAATTGTGGTTACC ATAGATTGGGATGTTGAGAATAACAATACAAACTAGCACAAATTCACTAG TTGATACCAAATTCGGAAAAACTCGTTTCCGTATCTCTCCTATCGTCTAA TCTGGGAGTTTGTTAATCCCAAATGTTTTACGAACTTATAATGACTTTTA CAATGAAAAAATATACATATGTACAATGAAGAAAAATGATAAAAAATGTT CTTAACCTGTTATTTATAGTCGTGTAAGATTTTAGAATTTGGGAAACAGC CAAAATATATTTATTTTTTACTGTACAAAGATTTAGGTGCTCATTTTTGA TTTTATACAATATTTGTAATATTTTCAGATGGAAAACTAGCGGGAGCAAC GTACAGCAACAACAAAAATCTTGCAGGAGTCGGATGTGATATAGAGGTGG GTCTGTGTACTAATAATATGTTCCTTTTTTCCAAACAATACATCAATTTC TGAAAACTTAAAATGTTGAAGCAGCAAATATGTAAAACAGCAAAAATGAA TGCAATTTCTGAAAATAATATTTCACCCCTGTCTCAGTGACAGTGTCTGT AAAACCCCCTGGTGGATTTCATTAATACAAAATATCTACTGAGCCTGGAT TGCTTGTTTTCGAGCTGCCTTCGAGGTAATGAAGTGAATAAATAAGCGAT AATTGTTGCATTAACCTTCAATTTCATTTTTCTAGGGTCGTGACAACTTT ATGGAATTTGAACTTGGAAAGGATAATAATCATTTTACCATCAATTCCAA GATATCTGCCATTTTATCCTCCGCTAAGAATTTCAACGACTTCGACGACA AAGTTCATTACATCATGCCTATATCTGATCGATTTGGAAGAGGTATTTGC AAAATAGTTTAAAGTTTTTTAAAGGATTGTGATCCAAGAGACACTTAATG AATCCATTTGATTTCCACCCACGAAAAAAAGGAGCAACTAGAGCCCAGAA CTAGACTAAAATGATCTAAAAATCGAAAGTTTCTGATCTCAAAGGGCCAT GGTTTTCTTAAATTTGGACCAAAGTTTTATAAAAATCCCTTGCAACTGTT CTAAGAGTTTTTTCTCTCCAAGGTAAAGTCAATTTTTGTTATTTCGAACC GCAAATTTTAACCCTATTTGCGAAAATTAGTCCTCGCAAAATATTTAAAA TCAGGACTTCGGCCAAAACCCCTAGGAAAATGAAAGAAATTGGCAGAATA AGTGGTCGATTCGCGAAATTTTGTCCACACAAGAATTTTGGATTTTCAAT CAGCGAAAAACATTCCGCACGAAAATTAATCTATTAAGGTACTACCTACT GTTAGTTTTTCAAAATCTTGTTCCAATCATATTGAAAGTAACTTCCAATA TGAATATCACTGGGTCGATAAACGCAAACTTATTAATTTCGCCTTAGCGA AAGTATTACAATGAAATTGAAATCAAGTCAATAACTCTTGATAGACGGTG ATATACTTTTTGGTGATTAGTTCTTACAAAGTAAACAAAGGATGACGAAA AAGATGAGCATATTCATTTTTCTTATAAGCATTTACTTTATAAGAATCAA GTCAATAACTCTTGATAGACAGCCATATACATTTCGGTAATTAGGTCTTA CAAAGTAAACAAGGGATGGCGTGCAATATGAGCATATTTATTTTTATAAG CATATAATTTATAAGAGTTCTTAAAAATTAAACAGTAATTGTTGTTAAAT TGGTTTTATTTTTTTAGCGTTTTTAAGCCTCGGTGTTCTTGGAAAATTGT TTCATCAAGGCCCGATGTAGACAGGAACCCGTCTGCGTATTTTTTTAAAT CTGATGAATACTTGACGGGTCAGAGCTGTGAGTCCGATTTTGGCCTCAAA AAAATTACAGTGGGAAATTCAAACTGTCAGCCCATACCATGCTATATATT TCGCCATCAGTATATAGAATAAGAAATCATAGCATGGATCTCCAGGCTAG GCCCGATGTAAAGTAGATTTCAGATTAGCTTCAATCTCTACTTCTTGTTT TCCCCATGTAGCTAAAATTTTAGGCGAAACTTTCGACTTCAAGTCGTCTT GTTTAGATTAATCTTGTTTCAATCTTAGGCACAACCATTGACGCATGTAA AGCAGTGGTGGATAAAAGTTCATCTTCACAAAATCCAATGAAAGGAGCCG TTTGTCTTTCTTTTCTGACCAATGAATTTATTCGCGAAGAATGGAGTCAA ACGGAAAATTCTTATTGGTTCCTTATCAAAAGAAACGGCGAGGCTTACTT TAAAATCCTCTGCTTTGACAATAAATACTCATAGTAGTTTGTATTTTTAC AGGACTGGTGCATACATTAGTTTCAGGCCCCTTATTTTCATACAGTCTCC ATACACGCATGTGCATTTGATTCGTGTAAACTCTAAAGACGTTAATCTCA CTTAAGAGATGTAAAAAGCAGTTAATGCACACAGAACTGGAAAACCAGGA TTATTCCCCAGAAATTTCCCTACATTAATTTAATTGTTATCGAAATAAAA TTGAAGCATCTAATATATTTATCACAGGTCAAACATTTATTCATCCGAAA TTCGGACAACCGCTTGGATCAGATGAACTTTCTCGGACAGTTAATATTTT ACAAATCGAATCTTCACAAAGTTTCAAAGATGAAGTGTACAATGATATGA TAAGGTAATGTAATTCTAGAATCAAATTATCTATACTCCTGGTTTCAGCG GTATACATTTCATGGAATAAATAGCTTTCACTCGAACTAAATAAGAAACT GTTGCAAGATGTAAACCTTGTGGAACCTTGCTCAAAACTTTTAAGAAAAT AAGGGCTTCGATATTTAATTGTTTTGATCGTTTATAAAGGGTTATCTATG ATGAATCTTCCAAACCAATATTTTCAATCACATTTAGCGGTGTTCCTGGA TCAAAGATTCTATCAGACGTAATGATGCCAATATCTCGAGGGCCTTTTGG AGCCACTTCACAAAATAAAACATTGACTTATACTTGGAAAGCTGTTCCAA AGTCTGACTTCATTTTGACTATTGTGACGTCATCTGATTACGAAAAATCC GAACTCAAAATCACCAATCAAGGAGGGGCGGAAGATTATCATCGCCTTGA TCTATGGAATTCCACATATTTAGATGATCATATTTGCAAATACAGTGAAA CACAGGTAGCAGTCAAAGGTACGTAATGTTTCCAATGTAAATATATAAAG AACAAGAAGCCGGAGCGGCGTGAAGGTCCAACTGACGTGGCAATAACCGA ATGTCGCTCGTGCCGGGTTCCTTAAGTGACGCAAAAAAATTTCCTTCCCA TCCTCCACTCTGAGCTTCTATTCTTTAACACTTTCTTTGTATAGCTAATT TATGAGAAATTTGATACATTTCTCGAAATTTCGAAACTTTTGCCGCTGAT GGGATTCGAACCCATTAGCACAAAGCACTTTTGATTAGAACGCCAGCGCC TTAACCACTCGGCCATCGAGTCACAACTACATTAAGGAGTTCAAAGTTCC TTATAAACATGGTATTTACTCCAAACTTTACCCGGGGGCTAAAACCCTAA CCAGGGGTTAACTCCCATCCCAACCCTAGCCCTAACCCTACCTGAAACAA CCCTTTAATCTAACCAGGAAATTTGACTCTACTACCAATTCAATCCAAAA CATAGGTCAAACATCGCGCGGGTATGCGGGGCAAAAATTCTAGATCAGCG GTTGGTTTAGCCTGGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACTTGTTAATTTATT GCGCGCACAGGCCCCGACAAAGACAAAATCTTTTCGATCAGTTGCTTTTT AAAGGTCCATTCTGCTGCACGCTGGACCAATTACATATTGTACAAGTCGC TGTATCTGTTGAGCGATCGTCGCACATCGAATTCTGTAATTCCAAAGGAC TCTTTTGATGAGGACTTTTGTTCCTTGAGCTCAAACTTTGACCCTAACTG ATGATAACCCGTGACCTTTAAACGATCCGCCAATGAGAAACAAATAAGAT AACTTTTTGTGATCCCATATAGTAGAAGAGTTTTATGGCTTTTATTAACA CTGTAATAATTTCCATAATGCACCCCTGTCTCACAGCCCCGGTGGAACTT TTTTCCTTAGTGAAGATAAAGATTCCAATTGAAATGCTGGGGTCCCAGGG TCTGTGATACAGGGTTGGCATAATATAATAAAGACACTCTCGCGTTACTT TCTTATTAACTCATTTACATCTTCTTAAATGTTATGCTTAAGTCTGTTTA TTGAAGATAATTTATATAGCTACTACAGAGCCTTTACATAGTTATTTCTT AATCTTTTCAGACTTGGCAGTAATCAAATTTCCAGCAGATGCTTTTCTCA GGCCAAGTATTTACTTCAAACTAGAGACAAATGAGACGGTTCAGGAATTA AAAGACTTGTTCATGCCTGGGGAGACAGCAACACCTCGTGGCCTCTTCAA GGTATTCTTAAAGTTTTGGATTCAGCTAGACTAGAGTCCAACCTCGTGTT CATGTATCCCAGGCTTTATTTACACTACTGATGGACGCCAGATTATTCTG GGAACGAGGTTGACAAGAGTCTACATCTGACTGAACTTTACTTTCTTATG ATTTTGATGGTCTAAGTCTAGTGAAGTAGACTAGGGAAAATTGCCATATT GGAATGTCGGAATGTTCATTTATATAAAAAACTCAGGTAAGTTATGCTAT GTCTCAAAAACATGAAAAAATTAGCATAATTTTTGGAAAGCATTCCACCG GGAAAAATGAGCAAACCAATGATTTAATACGAAACAATTAGGTAACACTC TTACAGGGAAACTTCATCATGGTGAGAACCCAAAAATAATCAGATAATTT ATTCTATTCATTTTCTTTATAGAGTATCGATGTTTTTAAAAATATACGGT TATCGGCACAAGCTACAAAATCTATGGATCAATATTGGAAAAATGATACA TCAGAGAAAGCAATCAGTATCATCGCAAGGTAAACTCTCTTAATTTCCCA TTGGAATTGGAAGTATTTATACCTTGTCCACAAGAATTTCTACATGCCTT ATTAGCACACCCCCTTCTCACAGACCCACTGGGACCCCTTTCGACTGGAA AAACTTGCCAAAATATCTTCCCCAGTGGAAAATTATACTCCATTTGTGTC CCCACTGAAGGTAATAAAATAAACCAATCCCCACTGTAAATTATCACGCT ATTTTTACCCAACCCAACTGAATTTTCTGACTTTAAAACAATGGAATTTG AATTCCAAGCATTGAAAACGTGGGGATATCAATCTTCATCGAGATTAAGT CTGTTAATTTTACCCCCACTGGCTGAAAAAATCCTACCGGGTCTGTGAGA AGGGGGTGTATTAGCGGACTACCTACCTTATAATTTACCTTATTCACGTA TTGCGTTCTGGACGAGATGTCACTTAATCTAAGTTAGTTAAGTTTGTTAC CCCTCGTAATTGATTACAAACAAAAGGAACAATCTTTGGATCAAACCAAC CTCGCTCCCTGCGTATTATCAGCTTTTTAGGGCTTACTGATAGCACCAGA TAACACCCTGACATTGACTGAAAACAAACTGTTTATTTTGTAGGTACATT GGTATGGAGAATGGTTTCTTCCGTATTTACCCTGGCTTACTGATGAATCC TTCATACGACCCAAGAGCTCGACCATGGTAATCTCTCCCGGCATACCCAT TTACATTTACGAGATTGCTAAATCCTTTGAAAGGCCTTGTTGTATGTTGG GTCGCACTGATGCTATACTTTAATCTTTTGATCCTGCCCGGATAAAAAAA TCAATGACATTTCTTTTAATCTTTAGAATTTTGAAGCTATGTTGGAATGA CATTTAAAAGGATAAATGCTCTCATAAAAATATTTGATATTATTCTTATC TTCCAAGGTACCGCCTCATGATTGCTCAAAAAGGGATGACATTAACCACG CCCTACTTGGATGCCTTTACTGGTGAAACTGTTATGACTCTTGGACAAGT CCTACACATGTAGGTATAGTTAGTCGGATAGTATTATATGTGACTAATAT TATATAATAATTATGGGTTCTATAGAAGCCACCAGACCTGCAGTCAATTA GAAATATTTATTTAGTCAAGCTAAATTTCAAAAACAATGATTTAAAAGAA AGGCTTTAAGACCAATATAGAATCGGGTGGTCTTGCAACATTGAGTCAAC ACATAATCTCTTTTCCAATTATCAGGGGCAAGACTTCGACAGAGAAAGCA GGGAATATAGCGATGGATTTCAAACTACCCTACTTTAAAGTGTTACTGGA TAAGTCAATCAATGAATGCGAAACTGATGGGTAGGTTGTTCTCTAATTTT CCTATATCCAAACATACATTATTTCACAAGTTTTCTATGCAGTTAAAATT AAATTTTGACTATTCCAGAAAAAGGTTCCCATGTTAAAGGACATTGGCTG CCCTTAAAACACAAGCAAGAAAACTTATTTAAGGAGAGTCACTGTATTCT CAGGGCGTTTATGACAAAAATCTAGGAATGTCTCCAAATTTTGAAAGGAA ATCCAAAACGGATAACTTTTCTTAGACCAGCCAACCATTAGAGCTTATCA GATTTGAGAACTACGTTTTTACTACAGAGCATGTGTTGTGATTGATCGAA ATGGCTTCGTGGTTTACCAATCGAGTTTTATGGAAAAGAATGAAAATTCA ACCCTCGAAAATCAACACATCATTAAGATGGTAGGTCATAGAAAGATTTC TTGTTCAACCTAACAATACTTTTTTTGGCTCTCGCCTAAATTCTCACTCC AAATATTTTCGATTTTTAAACGACGGTTGGCTTTTACCTGTCAGAGATAG AGACCAGGTTGAGAAATTTTAAAACCTAAGACACCCCTGTGTCACAGACC CGGTGGGACGTCCGTCCTATTGGAAGATTTGTCTGACATCTCTCCCAGGT GGGAAGATTACCCTAAAATTTCAGCCGACTGCAGAATCGACTTTGATTTC ATCCCCATTTGAAATTAAAAAAAATCAAAAAATTGTATTTCATTTTTTTG AAATGGGAGCAAGAGAATTTCTATCCCCATTAGGATTTCGAAAAAATATC ATCCCCAGTGTGGAAAGAAGTTCCACCGGAACTGTGAGGCAGGGGTGTCC TAAGGTGTCGGTGATGATGTCACTAATTTCGCCGTTTTTTGATTTTTAGC ATAGTCGAGTTGCAAAGAGCATGATCGAAGAGGGAGTTATGATAAAAAAT TATTGTTTGGAATTCCGAAACAATATAACCATCAAGGAATGGTTTTACTC TGTAAGTAATGAGTATTTTACTGTTTGATAAAAATTCTAAAAATTTATCG AGGTTCCACTGCATTATGCATTATTTGAAATTAAACTAATCTTAATGGCA ATAGGCCTTTTCATAAATTACGTCACGAACATCACTTGCCTCGTATTCAA ACAATTACCATGGTGATTATGTCCCCTGAGACATTAAATCGTTTTTTTAT GAATAGGAAGTAGTTTTAAGAAGATCCGTTGGGATTTAATCACCATGGCA ATAATTTCAAAACGAGGCAAGTGATGTTCGTGACGTAATTTATGAAAAGG TCTATTTGACTTGTTTCGCTCTCAGGGTTTGCTCCATTTCAAGCCATTAA AGGCCTTCGTCAAGTTTATTAGGAAATTTTAATTTTTATTGACAGGTTTT TATTAACACTAAACTTTATTAGTGATAAAAACATGTTCAACCTCGTCCCC TAGCCTGTACCAAACTCTTCTTCGCTGACTGAAAGGATAACTGGAAATTC GACACACGATAAGTTTTTTCAAAATATCAAAAAACGCCTATAGGAGGGAT GGTACAGGCTACCTCTCCCCTTGCCTAATCTTTTTTTTTTTTTCAGCTTG ATCACGTGACCGAAGCGAAGAAATATGAATCGAATCGAAATTGTTTGGAT TATCGAGTTGTTCCGATTGTTGATTCCAATCTTTTATTATTGTATATTAA TGACGCTTGCACTTTACCAGAAAATTGTAACTGTGAAGAACCAATCAACA ACGTAAAGAAAATTCTCAAACTTGCACGTTTTTTTTGAGAAACTAGTTTT ATACCAATCAGCCTCAATGTTTTTTAAGAAATCGGCCTTTTGAGCCTTAA ATGTTTCTTACATGTTTCTAAACTTTTTGACATGATCAGCCTCGTGGAAG GCTGGATTGGAAGGTTCTTAAAAAAAAACGAATTAAAAATTTTTATTTTC TCATTCTCAGCCTCAGCATATTTCTGAGATGTTTCTTAGTTTTTAGGCAT TCTGAGCCTCGTGTTTCTTAAAAGTGTGTTTCTTAAAAAAAAAAAAGTGT ATTTCAAAATAAAGTGGAGGCTTTTCAACTATATAACTCGAATGTTTCTT TAACTCGAACAAAATTTGTGTTCCCCGTGCATGCTCGAGTTATGGAGACT CCACTGTATATTCCAAAAGTTTTGACCTTCAAAACATATCATTACGTATG GTTAAAAATGCAAAAAGCGCACCTGAGAAACTAATTTCGTTGGTTTCGTT GTACGGAATACAGGTGGTCGAAATCATTTAAAAGCGAATTCTACTATTTT CAATTTTTCAGGAAAGATTTGGGTATTGTTCGAACGATATCAGCGAAACA AATTGTGAATGTCCTTGCATACAACCCGTTACTTGTCTCAGTGATCTTCG AATTACGTAAGTCTTTAAAGTTTTGGAGAAAGTTTTTGCCAAGCTTCGTT AGATTTCTTGGATGGTTTCTTTGTATCAAAAATACATCTTCATTGTACCT CCTAGAATTTTTTACTATTTTTCATAGCCCAGGCAGACTTGAATGCAACC CAGAGGACAAACGAAAAACAGATTTCTCAGAAAAATGGTTCAAAGGAAAC ATTTCAGAGCTTACTCTCTGTTTTGACCCTGAATGCAAGAAACGGTGAGT GTCGACGTGTCGACCAGATTCGTGGTTGGTGTAGAAAAAGTACTGAGAAG TAGGAAGAATCATCCTAATTCTATCTTTTTTTTTTTATTCTTAATTTTCA ATTGTCATTTTTGAATTTTTAAACAATGCTTTAAAGTTCAAGTCAATTCA CTAATGAAATCTGACGTTTTGTTTTTGTATTGCGTAATTTTACGTAGAAA TCAGACATTACATGTCAGGGTATTATCTGGCGCTCTGGAGCATCGAAAAG CTGATAACATGCAAGGAATACGAGGTTGCCCCTGGTGTTCAAGGTGGTCT GGATAATAAATCTTATAATAGAGTAAAGTCTCAGTAAAATGAGGTTGAAA ATCTAGGATGATCAGTAAATTGAGGTCAAAAATCTAGGGTGGTCCAAAAA ATGAGGGGTTCTGAACAATTGAAATAAAACCCAGGGGGGGGGTAAACTTT CCAAAAAAAAGACCTCCTCAAAAAGGGTACAATTTTCTTTCTAGAATAGC CCTATTCTCTTTATAATGAGGTATAACATTTGATAATATGTTTTCATATA AAGAACAAGTTTCAATTTTTTTGATACTGATCTTGAGCATTATTTTACTA ACACTTTCACCTACCTCATAAACTTAGGAATAGCTTAAGAATCACACAAA CATAAAAGCAAGGGCTACAACGAGTGGAAGCTTTTAACCAGAATAAGAAC ATTTTTTTATGCTTTGACATTTCTCAAACAAAACCTGTGGTAGTGAAAGA CCAATACAAAAAACGTTAGAGAATATAAAACAAGTTTGGCCCCCTACTAT TTACAGTTGAAGAGAAAGAAAGTCAGGGGAAAGTAAACAAAACTTATATT CCCGACAGTCAAGATTTTTAACGCTGTATGCTATAATTACTTCTTGCTGA TCAATGGTACATCCCCTTCTCACAGACCCGGTAGAATCTTTCAGCCAGTG GGGTGAAAATAACGGACCAAAACGTGATGGAGATTGATATTTCCATGTTT TGAAAGGCTGGGGATTTGACGAAATCAATTGTTTTTGAACCATAAAATTC AGCGGAGATTGAAAAAAATAGCACAGCTTTTTGTAGTGAGAATCGGATTA TATGGTGACAAAAAATGATTTATAATTTTTCAATGGAGCCGATATTTTGG TCAATTTTTCCAGTGGGAAGGATTCACAGNTCTTAGTGGTGACAAAAATT GATTTATAATTTTTCAATGGAGCCGATATTTTGGTCAATTTTTCCAGTGG GAAGGGTTCACAGTGTTTCGTGTGATTTTTCTGTTTACCCTTAAAAATGA TAATCATGCATTACAGGGTAGTCATTCAAGACTACATTTTGTTGATATAC CATTTACTTTTCAGCGACACATGGGATAATTGTGAAAGTTTCAAACCTGC TTGCAACTGGTGTTTCAAATTCCCAAATGGAACCCATGTTGCCGACGAGA AAAAGCATTGTGATTATTCTGACGAAGAATGTTTTCCGACGCCATCACCA CCCATCATAACGCCTGCACCACCCACAACACCTGACTCGCAAGAAACTGA GGACCTATCAGATGGTGCTATTGCTGTGATTATACTATTTAGTATAATAT TTGTATGCTCCATACTGGGTGGTATCTACTGGTGGTTCAATAAAAAAGCT AAACGAAGACAACGTAATAACAATAACAACGGGAATAATTCTAACACAAC ACTTACTCCTCGAGCCAACAGTGGTTTTGATGATGACCAATATCAACCAG GATATCAACCATCAGGCCACGCACCAAACGATCGACTAGGATCAGTACCA TCACCGACTGATACCAAAGATGCTGCAGTAGAGATAACAATGCCAGCAGT GTACGAGGAGAGACCTGCAGATGAAAATGGTTCAGTTAGTACCACGGCTT AAACCATCGCATAGTATGTAAAAATTAATTTTTCTGAGTACTATTCAATA AACAAAGACTTAAAAGATTTCATTACATTAAAAGGACATTTCACATCAGA CACATATTTCATATCAGGACAGTGTCTCCCTATTGTTTTCTTATACTGAT TTAAGCAAAAAGATGTTTTTCTTTTCCTTTTTTCTGACCAATCTTGCTCC ATATCCGTGTCAATCCGATGTGATAAAGCTTGTGAGTTGAAGTTGATGAG TAAGCAAACGATATCACTCTTATTTGAAAACAAAAGACTTTTTGAAATCT GAATAAGTTTACTACGAGTATTATTAGCAAAACGTTTTGCAGTTAGAAGT GTCCAAAAATATAATTTTATGGTGTTGCAAAACCGTAATCTGGAAACATT TTGGGATCCCTCTCCCTCCCTAGGCCCACTTAATGCAAGTCAAAGTGACT CATAAAAAAGAGCTTTTTTGAAGAACAAATTAGTGGGTTGCTTTGAAGGA TCTTATATTACACGAAGCTGACATTTTGTACTTTCAAGATCCTGCAGATT CTAATTTATTTTTTCTCGACACATTGTAAATATCTAGCTATTTTATTGTA TACACACCTTTCATTGTATATTTGGGATAGAATTTTTCAAAGTC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000321XLOC_000321Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000526-exon-sc0000002-1575043694:357173..357435TCONS_00000526-exon-sc0000002-1575043694:357173..357435Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:316342..316367TCONS_00000526-exon-sc0000002-1575043694:316342..316367Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:315364..315482TCONS_00000526-exon-sc0000002-1575043694:315364..315482Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:314477..314612TCONS_00000526-exon-sc0000002-1575043694:314477..314612Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:314071..314145TCONS_00000526-exon-sc0000002-1575043694:314071..314145Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:313832..313963TCONS_00000526-exon-sc0000002-1575043694:313832..313963Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:313400..313458TCONS_00000526-exon-sc0000002-1575043694:313400..313458Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:312986..313127TCONS_00000526-exon-sc0000002-1575043694:312986..313127Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:310670..310828TCONS_00000526-exon-sc0000002-1575043694:310670..310828Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:305705..305831TCONS_00000526-exon-sc0000002-1575043694:305705..305831Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:305216..305493TCONS_00000526-exon-sc0000002-1575043694:305216..305493Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:303905..304047TCONS_00000526-exon-sc0000002-1575043694:303905..304047Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:303445..303551TCONS_00000526-exon-sc0000002-1575043694:303445..303551Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:302908..302991TCONS_00000526-exon-sc0000002-1575043694:302908..302991Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:302495..302596TCONS_00000526-exon-sc0000002-1575043694:302495..302596Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:302125..302226TCONS_00000526-exon-sc0000002-1575043694:302125..302226Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:301516..301618TCONS_00000526-exon-sc0000002-1575043694:301516..301618Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:300102..300203TCONS_00000526-exon-sc0000002-1575043694:300102..300203Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:299489..299641TCONS_00000526-exon-sc0000002-1575043694:299489..299641Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:271380..271474TCONS_00000526-exon-sc0000002-1575043694:271380..271474Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:271142..271258TCONS_00000526-exon-sc0000002-1575043694:271142..271258Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1575043694:268592..269771TCONS_00000526-exon-sc0000002-1575043694:268592..269771Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:357173..357435TCONS_00000526-exon-sc0000002-1510915933:357173..357435Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:316342..316367TCONS_00000526-exon-sc0000002-1510915933:316342..316367Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:315364..315482TCONS_00000526-exon-sc0000002-1510915933:315364..315482Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:314477..314612TCONS_00000526-exon-sc0000002-1510915933:314477..314612Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:314071..314145TCONS_00000526-exon-sc0000002-1510915933:314071..314145Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:313832..313963TCONS_00000526-exon-sc0000002-1510915933:313832..313963Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:313400..313458TCONS_00000526-exon-sc0000002-1510915933:313400..313458Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:312986..313127TCONS_00000526-exon-sc0000002-1510915933:312986..313127Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:310670..310828TCONS_00000526-exon-sc0000002-1510915933:310670..310828Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:305705..305831TCONS_00000526-exon-sc0000002-1510915933:305705..305831Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:305216..305493TCONS_00000526-exon-sc0000002-1510915933:305216..305493Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:303905..304047TCONS_00000526-exon-sc0000002-1510915933:303905..304047Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:303445..303551TCONS_00000526-exon-sc0000002-1510915933:303445..303551Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:302908..302991TCONS_00000526-exon-sc0000002-1510915933:302908..302991Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:302495..302596TCONS_00000526-exon-sc0000002-1510915933:302495..302596Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:302125..302226TCONS_00000526-exon-sc0000002-1510915933:302125..302226Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:301516..301618TCONS_00000526-exon-sc0000002-1510915933:301516..301618Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:300102..300203TCONS_00000526-exon-sc0000002-1510915933:300102..300203Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:299489..299641TCONS_00000526-exon-sc0000002-1510915933:299489..299641Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:271380..271474TCONS_00000526-exon-sc0000002-1510915933:271380..271474Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:271142..271258TCONS_00000526-exon-sc0000002-1510915933:271142..271258Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1510915933:268592..269771TCONS_00000526-exon-sc0000002-1510915933:268592..269771Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:357173..357435TCONS_00000526-exon-sc0000002-1491911889:357173..357435Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:316342..316367TCONS_00000526-exon-sc0000002-1491911889:316342..316367Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:315364..315482TCONS_00000526-exon-sc0000002-1491911889:315364..315482Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:314477..314612TCONS_00000526-exon-sc0000002-1491911889:314477..314612Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:314071..314145TCONS_00000526-exon-sc0000002-1491911889:314071..314145Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:313832..313963TCONS_00000526-exon-sc0000002-1491911889:313832..313963Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:313400..313458TCONS_00000526-exon-sc0000002-1491911889:313400..313458Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:312986..313127TCONS_00000526-exon-sc0000002-1491911889:312986..313127Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:310670..310828TCONS_00000526-exon-sc0000002-1491911889:310670..310828Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:305705..305831TCONS_00000526-exon-sc0000002-1491911889:305705..305831Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:305216..305493TCONS_00000526-exon-sc0000002-1491911889:305216..305493Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:303905..304047TCONS_00000526-exon-sc0000002-1491911889:303905..304047Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:303445..303551TCONS_00000526-exon-sc0000002-1491911889:303445..303551Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:302908..302991TCONS_00000526-exon-sc0000002-1491911889:302908..302991Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:302495..302596TCONS_00000526-exon-sc0000002-1491911889:302495..302596Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:302125..302226TCONS_00000526-exon-sc0000002-1491911889:302125..302226Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:301516..301618TCONS_00000526-exon-sc0000002-1491911889:301516..301618Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:300102..300203TCONS_00000526-exon-sc0000002-1491911889:300102..300203Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:299489..299641TCONS_00000526-exon-sc0000002-1491911889:299489..299641Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:271380..271474TCONS_00000526-exon-sc0000002-1491911889:271380..271474Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:271142..271258TCONS_00000526-exon-sc0000002-1491911889:271142..271258Clytia hemisphaericaexon
TCONS_00000526-exon-sc0000002-1491911889:268592..269771TCONS_00000526-exon-sc0000002-1491911889:268592..269771Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000002supercontigsc0000002:268592..357435 -
Expression

Hover the mouse over a column in the graph to view expression values.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0.108226 0 0.08196 0 0.0948943 0 0.144446 0 0.0989289 0.136981 0.0457539 0.491005 0.482449 0.555366 0.60304 0.39505 0.484109 1.09529 0.00130435 0.302234 0 0.469982 0.502444 0.13957 0.184447 0.601966 1.80348 0.0680389 0.000185305
Blast
BLAST of TCONS_00000526 vs. Swiss-Prot (Human)
Match: CAHD1 (VWFA and cache domain-containing protein 1 OS=Homo sapiens GN=CACHD1 PE=2 SV=2)

HSP 1 Score: 157.532 bits (397), Expect = 1.089e-38
Identity = 215/885 (24.29%), Postives = 361/885 (40.79%), Query Frame = 1
Query:  295 EGRHFVIVLDYSEKIQNT-IDIMRKVATTLFKLFTSKDMISVKFYHEDNLVPADKTADCL------KISSQATPYIKDKILGEIETKQPKGDAASYSKVFRESFTALKNDNSN-----QTEKHFIFVTSGHYIDNWSEID-----QVFKERRKTNSECND--MYFSLLLINDG--KLPKANFVKN----KNLKEGCNDNFIDFELSGD-------NNHFTINSKISEILPSGRNIDDKVYYIMPISDRFGRGTTIDACKAVVDKSSSSQNPMKGVVCLSFLTNEFIREE---WSQTENSYWFLIKRNGQTFIHPKFGQPLGSDELSRTVSILQTESSQSFKDEVYNNMIS--------GVPGSKTLS-HVMKPISRGPFGATSQNKTLTYTWKAVPKSDFIMTIVT-SSDYEKSELKITNQ--GGKENYHRIDLIPDNYANDLCKYSSEHVATKDLSVIKFPADAFQRPSFYFKLETNETVKELNDLFTPGNTATPPDELFKDMDVFNHLRQSVQATHLMEGYWKNDTSEAAKNT--LTRYIGMHNGFFRTFPGHLMNPSYDPRARPWYRLMIAQKG-ITLTTPYPDAFTGEIVMTXXXXXXXXXXXXXXAGNIA---MDFKPLYFKELLERSIKECASGA-----CVVIDRNGFVVYQSSFMEENENSTLENQHIVKMHGRLAKTMIENGVMI-KNYCLEFRNNVTVKEWF---YSLDHVIEAKSYSKGCLKDYHVVPIIDSNLLLLYINDRCDVKEKCTCREPINGERFGYCSNDISETNCECPCIQPV---TCLSDLRITPGRLECNP--EDKRKTDFSEKWFKGNISELTLCFDPECKKRDTWDNCESFKPACNWCFKFPNG-THVADEKKHCDYSDEECF 2745
            + +H V++LD+   + +T + I +  A  +       D ISV       L  AD    C          S AT   K K+   + + +       ++  F+++F  +++ N+N      T+   I++++G    + SE D     QV  E    NS  N+  M  +  L+NDG   L +  F+++     + K G  D      + G        +N  T   +    LP+ R ID+ V+  +P SD  G G  +      V K     N + G+V +  +   +I E+   +  +  SY FLI   G T +HP   +P    E      I+  E+   F + V  N++S         VP + +LS H+ K    G      +   ++Y WK V  + FI+ IV    +    +LK  N     K  YHR+DL+    A   C +  + +AT +   I   A +F  P  +      + + E    +   NT      L  +  +   +R  V AT  +   W      ++ NT  + RYI   NG  R +PG LM+ ++DP  R WY   +A  G I+LT PY D      V+T+   +      +     +A   +DF   YF ++L   +  C         C +++  G++V   + ++   ++ +E QHI      +A  ++ +   + KN C  F +  TV+ ++    SL   +    +   C K Y +  I  +N  +  +N+ CD    C C      +R     + + +  CECPC  P+    C  +L     R   NP  E  ++         G    L  C +  C +R    +C      C WC    +G TH+  +K +C    +ECF
Sbjct:  225 QSKHIVVILDHGASVTDTQLQIAKDAAQVILSAIDEHDKISV-------LTVADTVRTCSLDQCYKTFLSPATSETKRKMSTFVSSVKSSDSPTQHAVGFQKAFQLIRSTNNNTKFQANTDMVIIYLSAGITSKDSSEEDKKATLQVINEE---NSFLNNSVMILTYALMNDGVTGLKELAFLRDLAEQNSGKYGVPDRMALPVIKGSMMVLNQLSNLETTVGRFYTNLPN-RMIDEAVFS-LPFSDEMGDGLIM-----TVSKPCYFGNLLLGIVGVD-VNLAYILEDVTYYQDSLASYTFLIDDKGYTLMHPSLTRPYLLSEPPLHTDIIHYENIPKF-ELVRQNILSLPLGSQIIAVPVNSSLSWHINKLRETG-----KEAYNVSYAWKMVQDTSFILCIVVIQPEIPVKQLKNLNTVPSSKLLYHRLDLLGQPSA---CLHFKQ-LATLESPTIMLSAGSFSSPYEHLSQPETKRMVEHYTAYLSDNT-----RLIANPGLKFSVRNEVMATSHVTDEWMTQMEMSSLNTYIVRRYIATPNGVLRIYPGSLMDKAFDPTRRQWYLHAVANPGLISLTGPYLDVGGAGYVVTISHTIHSSSTQLSSGHTVAVMGIDFTLRYFYKVLMDLLPVCNQDGGNKIRCFIMEDRGYLVAHPTLIDPKGHAPVEQQHITHKEPLVANDILNHPNFVKKNLCNSFSDR-TVQRFYKFNTSLAGDLTNLVHGSHCSK-YRLARIPGTNAFVGIVNETCDSLAFCACSMV---DRLCLNCHRMEQNECECPCECPLEVNECTGNLTNAENR---NPSCEVHQEPVTYTAIDPGLQDALHQCVNSRCSQRLESGDCFGVLD-CEWCMVDSDGKTHL--DKPYCA-PQKECF 1064          
The following BLAST results are available for this feature:
BLAST of TCONS_00000526 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
CAHD11.089e-3824.29VWFA and cache domain-containing protein 1 OS=Homo... [more]
back to top