Error message

  • Notice: Undefined variable: cmd in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 96 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).

XLOC_000266 (gene) - C. hemisphaerica

Overview
NameXLOC_000266
Unique NameXLOC_000266
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:2886611..2886962-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000266 ID=XLOC_000266|Name=XLOC_000266|organism=Clytia hemisphaerica|type=gene|length=352bp|location=Sequence derived from alignment at sc0000001:2886611..2886962- (Clytia hemisphaerica)
AGAAAAGCGCTATGTTTTGTCCAACGAAGATCGAATCCCTGAATTGCAGA AGCCAAATCTAATTTACAAGCTATCGTGCCCAGGCTGTGGAAAAGACTAC ATTGGTAAGACTGACCGTTGTCTGTCCATTCGCTTAAAGGAGCATGGTAC CCGAGACAATCAGCCAATGAACTTGCATTTGAAAAACTGCCAAGATTTCT ATCATTATGTTTCATTGTTTAACTTGCCATCGTTGATTGATGACAATTTA GAGACAATAGAGTATGATGACCATTTGCTAAATGCTGTATTTGATAATTA TTCTATTGTAGATTCTTCTTTGTCATGGTCACATTTAATATTCTTAGAGA CA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000392TCONS_00000392Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00000392-proteinTCONS_00000392-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2886611..2886962 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.63 0.54 2.9 0.63 0 0 0 0.92 0.21 0 0 0 0.5 0 0.28 0.3 0.19 0.19 0.08 0 0.24 0 0.29 0 0 0 0.34 0 0.49 0.28