Error message

  • Notice: Undefined variable: cmd in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 96 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).

Blg00414.0 (mRNA) - B. lanceolatum

Overview
NameBlg00414.0
Unique NameBlg00414.0
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000078:664632..674912+

Legend: polypeptideexonCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00414.0 ID=Blg00414.0|Name=Blg00414.0|organism=Branchiostoma lanceolatum|type=mRNA|length=10281bp|location=Sequence derived from alignment at Sc0000078:664632..674912+ (Branchiostoma lanceolatum)
ATGCACTGGGTTTTGATTGACGCGACGGGCGCACACATTGTCATCATGGG TCAGGGTGAAAATTTGAAAAACATCTTCTCTATTGTCTCATGAATGTGTG TTCTTAAGGCACAAGAACTATATAGTTAAGATGTAGGAGTTAGTGTAAAT ATGTACTCTACTGTATATATTCTTAGGTAATTACCACACTCAGGGCCACA CCAGCTGCGCCACCGTGGGCCACGCCAGTGATGCCGGCGCCAATGCCACA GAGGTGGGTGCAGTTATTGCTTCATGTAAAAAAATGAGTCATTTGAAACT GAAAGGTTAATATTACCACTTTGCAATTGGCTTAATGAAGAACTCAGTAA GCAGGTTTCAGCTGTTTTGTAATGCAAGGTAAACCTAATTCTTCAATACT TGAATTTTGCGGCAAACTGGACAAAGTGGAGAGAGTTCGTTGAAGAAGAA CTGATTGCAGCTGCAGGGTGTCCAGACTACTGCAGCAGCAACAAGGTTCT CCTGACAGGGCTAATTTGACCAAATTGCCAGCCCTCACATGTTGTGACCA CTGTAGGGCCCCTCGGGACACAAGGCTCTGGTAGCAGGAGAATATAAATT TTATATATTATTATATGCTTTGCTTGCAATAAGATAACAATGCCATGAAT CATTCATTTGCCAAGAAGATTGATATGATTTGATAAGCATTCTTGTGTGC CTGTGTGTAAGATACTCAAGAGTGCCTGGATTGATTGTCACATTTCTTAA ATGGGTCTAGGTCTTGATGATACCTGGGAATGATTAGATTCGGGGGTCCC CTAGCAACTTTCTATTCATGAAAACAGAAGGCTGGGCCAGCCTTCTGTTT TCATGATTTTTTTTTCTAACATTTCTTCTTTTTTTTTTGAAAATTAAAAT CCGTTAACCAAGAAATTAATTGGTGTGGCATTATGAAGCAGTTTACAAAA ATCTTTATTTTGCATACCCTTTAACTCTTTGGCCCAGTGGTATTGGTCAT ACCAAGATTCACCCAGAAAGGATTGATCTCTATTTGTGAATTCTGTTATC AATTATGAATGGTCTGAATCTTATAACAAAATTCAGATCATTCTGATGAA GCTATTCACAGAAATCTTGATGTTGCAATTAGTATTACCCTTTATCTCTG TAAGTCTTGTACAGTACAGTATACAAAAATTTTCTTCGAGAGATTCTTAA TTGCATTGGCCCACTGACAACATTAAGTGTTGAAGTTGATAACATTTGTT TATCTTTTACATGTATGTCTAATAGAACACCAGGCTAGAGGACTTCCTGC AGACAAAACACAAACTCATCTCAATGGTGAACGAGCTGTTTGACGAATGC TCATCCGAACAAGATTTAGTCCTTAAACACCTGCACGGAGATGTTCTGTC TTCAGCCAACATGTTTGTCCTAAAGGGCGTGTGTGGAGATGTAAGTCAAT TTAAGAGCTTCGCATGTATTTCTGTGTCTTAACCTACGCCTAATCTGCAC CGTGCTCCATTTAGATACTGTAGACTTATATTAAGTGACTGTGTTTTTTT CTAATTTTCTGATTATTAGGACTTTGTAGAATGCAGAAAAGAATTGATAA ATTATTTCTCAACATTATTCAATGTAACCGACTTCCTGCAATCTTGTACT GGAAGTTGGCAGAATTATTCCTGGACGGCATTATTGCCCCCAAAACATAC CAGGACCAACTTGACACATTCAAAAGCCTGTAGAGTGCCAAAGGAATTCT ACATGTTGTATACTGTCCAAATCAAATTATGTGTCACAATGCTCACATTG TTGTCCCATCAGATTGAGGAGAGGTACAACTGGGCGAGGGAGAAGGCTGC GGACCTGAGAACACAGTTAACAACTCTGTGGGACAGACTGGAGATAGAGG AGGCAGAGCGAGAGGCCTTCACACGGGAAAACCAGGGCTTCAAACTCAGT GTCTTGGCAGCCGTAAGTTACCAGATTCCTCCTATAAGTGTAAGGCTATA CCATCTTTAATTTTATGGATGACATCCTCTGGAGTCCCCAAAACTAATGC GAGAAGGAAAAAAAAAATCTAGCCCCCAAAAAAAGTCAGGCTATCACATG ACGCCCCGCTTGAGTGGTTACGTGCCATAGTCCTGATCTTGGAGTTCGAA AACAACTTCGCCTGATTTGGAATTCGAAAACAACTTCATGGCACAGAAAT AGGCATGTGCAGAAGGCTCATTTACGACAGAACCACGTTTTGCGGTAGTA TATATAGTGACTATTACGACAAGCCGGCTCAATGCTGCCCCTTTGCGGCA ATGTGAGTCTGCAAGTTTCGGAGCCTCTTCAGAGGTGATTTTTTATTTTG TTTTTTTTTTGAGAACAGGCGAAAATCAGTGCGCGCGCATATGTCATCCA TTAAATTAAGCTAACACAAAGGGTAATTACACAAAAAGATGAGTTGCTCC ATCACTAAATTGGTATCACTTGTCGAAATTGCCATGAACGTGGCAGATCG AATCATGAGTACTGGGGTTAGGAAAATAAACCCACAACGTAGAAGTTTTT GTGATGCCTATTGTTGCTGCTGACTCAAAATGTTCTATGCACTTACATGT TATGTTTGTTGTGCAGTTACAGAAAAAGGTCAGTGATTTGACCAAAGTCA AGCTACAAAACATCCATTATTTTGTGACAGGACTGAAAGATGAGGTCACA AAGCTTCACTGCGATGAGGAACAGGGTAAGTGCAAGGGTAAAAATAAGTA GATTATACTAGAGAATAACCTCTTAAGAGATGTGAGTTTGGATTTGTATG TAACAGCCATTGCCAGTGGCTTGAAGTTCAATCTTAAAATCCTTCATACA TACACTTTTCTGTGTACAGGGCAGGACCCATCTCTGTATGGATAGTCCTT CGTTGGCCCAAACAATTGTAACAAAAGGGGGGTAGTCCACTGGTGGCCCA TACTCTTTCTCATAAGTGCTGCGTGCTAAAATCTAGAAAGCAGTAATGTA CCATTTTTTTGAAGTCTTTCATCATACAAAATTTAGTCCTAGAAATGTCA TTAAAAATTAACCGGAACAAATTTAGTTAGTGATTCTTTTCCAAAGATGT CTGTGTTTTTGTGTCAGGTGAGCAAGAAGCCAGACTCAGGGGCATCCTCA GGTCTGTGGAGCGATGGGAGGACCTCTGGAAGAAGAGGCTTGCGCTTAAG GTGAGAGAAAACAGAGATTTTTGCAGTACTGTCACACAGTGGTTTTATGC TTGCGGTTTTTGCAGTGATCACTTCCCCGGGAACTTCAAACCACCGCAAA AACGTTAACGCTAATGATCTGTTTTCCACCACAATCCTGTTTGTTTTAAC CACAAATTTAAAACTACTGAACAATCCCTCTTCTTCCTACTGTAAAATTA AATCTTTGCAAAGTTATGCAGGTTCAGTATATGCAGGTGTTGGTGTTAAT GGATGTTCATGTTCTAGATTACCAAACAATTGGGAACATCATGATCAGAT TCTGTTTCTTTCTTTTAAACCATCGTTTTCAGGTTACAACAGAACGATCA GTGTCTAATCTGTTAATGGACATTAAATCTGGTCTGAACAGGATTTTGAT CAAATGGATCCTGGTCGTTGTAATTTGTATGAAAAAGAATAAACTTTTAG CATGGAAAGCTTGAATATCTAATAGTTTTTATATAATATCTATTACACGG CAACCAATTTGAAAGCTTCCTTCACTGTGTTGTACCGTGTTGCAATAAAA TGTAGGAGTCTTATTGGAAACATAATACGTTCTAAAGGTTCATTGTATTT GTAGATAGATACCAATATTACATAAGCAGGGTGCGAAATACTTTTTTGAG CCAGGTTGCACGGTGTGCAACCTAGGTAGAAAGCTAGGTTGCCCGTCAGA ATTTCAGGTTGCCCCACCTAAAATTCACTGATTTCTTGAAATTATATTTT GTAAGTACATAGTATTACATAGCCTTCAACAATATAACTGGTGCTTAAAT GTGTTTTTGTTTCAAAATAAAATTCAATGATATACAATGTTAATAAAACA CCACAACCCACAACAAACAAACTTATACAATTCATGTGACACGGCACGGC TATTTTTTTAGTACAAATAAATCCTTTTTTCAACACCCATAGACTTTTTG CTTTTTCTGCTCTAGCAAGAGTTACACTGCAATCAGTTACACTGCAATAG GACTTGTACCTGTACATTATTCTCATCCCTTACATAAAAGTTGCTACTGG GCCTATTTTCAAAATATAATAAAAGTACCCCCGGAATAAAATCACCTATA TTTTTTATTAGAAAATTCACAGGTGAGTTATCAATGATGTACATGTATGA TAATCATAGAATAAATACAATAGTCTATGTCATTGTCCAGTTTTTATCTC ACTGTCACAACATTGTTTATTCTATAATCATTGTTGCAAAGTAAAGAATC TTTAAATCCCAGCTTATTATTAGTAAAGTGGCTCCATCTCCACTTCTGTA ATTTTTAATTTTGCCCCAAAAAAAGCACTTACTAGCAACATTTCGCCCAT AGAAATACACAGCAACTCAAACACTGCCCTCTATCAGTAGTTGCCGGTAC TGCAGATTACACGTCATTACTCTCGCGCAATCACGCGATATTCAGCGAGA GTCGATGAATTCAACATGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGGTTTGAAAATTTACGAGAC TGAGAGCGAGTGTGTGTGCACACCACACGGGTGTGTGAGCTTCCTTGGTC CAATTATTTTCTACTTCGTCCAAGTAATTGCCGCAAAATCGATTTCTCCG GCCCAAAATTTAGGTAGCGCACCGCGCAACCTGGGTTAAGAGATAAGTTG CGCCAACCAAAATATTGTTGCGCTGCGCAAGTGCGCAACCGGGTATTTCG CACCCTGATAAGACAGATTTACCTTTAAAGTTAGTTTTAATGTGCTTAAC TTGTCTTCTTCTGTGATTGTAGACTGAAGAATCAGCATGAAATAGAATAC TCTAATTGTTTTTCTGCCAGTCCTGTCAGGACAGCACAATGGGGTGTCTG CAGTTAGGTATTATGGTGAAAAGGATATACATCATGTAAAACCATCTTGA ACAGACAGTAATGTCATTAACTTTTCTTGCAGAGACGAACACAGAGCCGA GGACATCTTTTCAAAGCCATTAATGAACTGACATCGGTGGAAAAGATGTT GTCTAAGGTTAGTTTGATACCTATGAAATGAGCCATGATAGACTGCCTTA CCTTTTGTACAAACATAACATGTACATGTATGTGGATTTCATGATAGTTT GATTTTGATTATTTTACCTGAGCAGTTATGGTGTGAAAGTGTTGTTTCTT TAGCAGAAATCTTTAAGTTTGTGACACTTTGAAAATCAATACAAATTAGT CATGTAATTAGTAATGCTATGTCCTCGAGTTAACTGTTTAAAGAATTGTA ATGCAATGCAATGCAAGACAGCATATATATGCATATACACTGCGTCATGA GAGCTCACTGCAAAACCTGCATGCAAAGTTCAATATCAAACCACCACAAA GATTTCAAAATTTTCAGTGCTTAATCCTCATTTTTCATGCAGGTTGAGAG CGAAGTTAGAAACACCGCCTCTAGCTTCATTGTGGAAGGTTGCTCCTTGG ACGAATTCTTCAAGTCACTGTGGAACGTTCAGGACAACCAAAGGGTGAGT TAAGATTTTGGCTGCATGGCTTAAATACAGCTCATGCAGATCAGTTTTTT CTTGGTAAAATTTCAAGTAGACTAAAAATATAAAAATTTTGCAATCATTA TGACTATTCTGTGCTTCTAAATTATATAATTTAATGTAATAGAGAAGAAA TTAATTTGTCCCAAAGAAAGGTACAGTAACTGTTCTTAGATAGATAAAAT TGCTCTGCTTTCAGCATGATGACTGTACATGTAAGACCCCAAAGAACTGC TTGCAGATGTGGTAAAAGGTTCATTCTTTCTGCAAAATCTGCCGTACTTG TGTTACCAGGATTGAGAAGTAGGTCATACCAAGCAAAATTTGGTTGCACG GCTCAACTCAGGGCATCCAAGGATTTTGCACGCCGTTCTTAGGCTTGCGA TTGATAATCTCAGTCAGCATTAATGGAAGAATCTGATCTGTCAGTCAAGA TGTCAGTGTAACCGTTACGGCAGTTCTGATTCCTGCACAGATTTTCTCAG CAAATGACATTACATCATCATTACATAATATTATATATGTGGATCATCTT ACACCAAGCACAACAACCAACAGTATAACAGTATACAACATCATGTATAC TTGATGATGATTAGTTCAGGGGCAGGGCTGTCTCAAGGACCCGTCCCTCT GTCCTAGAACTTTTCATGTTGGGGCTGACAAAACTTCATCCCATCCATCC CCAAAATCTAAACTTCATAACATGATGAAGCAGATGAAAATGTATCTTCA TAAAGTTATAATTGTTTTGTTTTTTATTTAATAACATGAGCTCTTAAACA ATGAGTGGGACAGAACAAAATGTAAAGCTGGGGACAACCCTGGTCTGTCC TCAGACCCTTTTGGCAAAACTCATCTCAAGCCAGTCCTTCAGGATTGTAG TACAGTAATGGTGAGGACACCAGTAAAACATGTATTTGCCTTTACAGCTC TCAGACTAGCAATAATTAAGTGATCTGCTATAAGTATGTATCATGTATCA TATGTAAATGTGATTATGAAGGGAAAATGTTATGATTAAATCTTGATTCA ACATGTGTACACAGGCTGGCCGTGGACGAAAAAGGAAGAGACCGTCAACT GATGATGAGGTATGTAAAAGAATACTTTCAGATGAAAGTCCTGTCTNGTA CTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACTTCCTACCCCCAC AGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTTGACCCTGTTC ACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAAGTTGTGACAGGC TCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTCTTATTTCAATTT CAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCACAGCTTCC TGTTATCATAACTGTAACACCATTGTATACCATTCACCTTTTATACACTT GCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAGAGATGTTG TACTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACTTCCTACCCCC ACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTTGACCCTGT TCACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAAGTTGTGACAG GCTCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTCTTATTTCAAT TTCAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCACAGCTT CCTGTTATCATAACTGTAACACCATTGTATACCATTCACCTTTTATACAC TTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAGAGATGT TGTACTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACTTCCTACCC CCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTTGACCCT GTTCACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAAGTTGTGAC AGGCTCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTCTTATTTCA ATTTCAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCACAGC TTCCTGTTATCATAACTGTAACACCATTGTATACCATTCACCTTTTATAC ACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAGAGAT GTTGTACTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACTTCCTAC CCCCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTTGACC CTGTTCACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAAGTTGTG ACAGGCTCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTCTTATTT CAATTTCAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCACA GCTTCCTGTTATCATAACTGTAACACCATTGTATACCATTCACCTTTTAT ACACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAGAG ATGTTGTACTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACTTCCT ACCCCCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTTGA CCCTGTTCACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAAGTTG TGACAGGCTCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTCTTAT TTCAATTTCAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCA CAGCTTCCTGTTATCATAACTGTAACACCATTGTATACCATTCACCTTTT ATACACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAG AGATGTTGTACTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACTTC CTACCCCCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTT GACCCTGTTCACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAAGT TGTGACAGGCTCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTCTT ATTTCAATTTCAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATACAC CACAGCTTCCTGTTATCATAACTGTAACACCATTGTATACCATTCACCTT TTATACACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAG AGAGATGTTGTACTTGGGGAGGAGGACAACCTTCGGGCGCTGCAGACACT TCCTACCCCCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACT TTGACCCTGTTCACACTCATTTTTTCAATATCTAAATTTAGCAAAAAAAA GTTGTGACAGGCTCTTGACGATGCACAGCCATCTTTTGCTATACTCTCTC TTATTTCAATTTCAACGTGTGGTTTGTAAGTTTGAAACAATTAGAAATAC ACCACAGCTTCCTGTTATCATAACTGTAACACCATTGTATACCATTCACC TTTTATACACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCC AGAGAGATGTTGTACTTGGGGAGGAGGACAACCTTCGGGCACTGCAGACA CTTCCTACCCCCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGA CTTTGACCCTGTTCACACTCATTTTTTTCAATATCTAATTTTAGCACATG TGACAGGCTCTTGACGATGGACAGCCATCTTTTGCTCTACTGTCTCTTAT TTCAATTTCAACATGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCA CAGCTTCCTGTTGTCATAACTGTAACACCATTGTATACCATTCACCTTTT ATACACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAG AGAAGTTGTACTTGGGGAGGAGGACAACCTTCGGGCACTGCAGACACTTC CTACCCCCACAGCAGCAGCAAAAGGTGAGCATTAATATGACACTGACTTT GACCCTGTTCACACTCATTTTTTTCAATATCTAATTTTAGCACATGTGAC AGGCTCTTGACGATGGACAGCCATCTTTTGCTCTACTGTCTCTTATTTCA ATTTCAACATGTGGTTTGTAAGTTTGAAACAATTAGAAATACACCACAGC TTCCTGTTGTCATAACTGTAACACCATTGTATACCATTCACCTTTTATAC ACTTGCCGTATTCCTTAGACCTGACACCAGACTCAGACTCCCAGAGAGAT GTTGTACTTGGGGAGGAGGACAACCTTCGGGCACTGCAGACACTTCCTAC CCCCACAGCAGCAGCAAAAGGTGAGCATTAA

Coding sequence (CDS) from alignment at Sc0000078:664632..674912+

>Blg00414.0 ID=Blg00414.0|Name=Blg00414.0|organism=Branchiostoma lanceolatum|type=CDS|length=1815bp|location=Sequence derived from alignment at Sc0000078:664632..674912+ (Branchiostoma lanceolatum)
ATGCACTGGGTTTTGATTGACGCGACGGGCGCACACATTGTCATCATGGG
TAATTACCACACTCAGGGCCACACCAGCTGCGCCACCGTGGGCCACGCCA
GTGATGCCGGCGCCAATGCCACAGAGAACACCAGGCTAGAGGACTTCCTG
CAGACAAAACACAAACTCATCTCAATGGTGAACGAGCTGTTTGACGAATG
CTCATCCGAACAAGATTTAGTCCTTAAACACCTGCACGGAGATGTTCTGT
CTTCAGCCAACATGTTTGTCCTAAAGGGCGTGTGTGGAGATATTGAGGAG
AGGTACAACTGGGCGAGGGAGAAGGCTGCGGACCTGAGAACACAGTTAAC
AACTCTGTGGGACAGACTGGAGATAGAGGAGGCAGAGCGAGAGGCCTTCA
CACGGGAAAACCAGGGCTTCAAACTCAGTGTCTTGGCAGCCTTACAGAAA
AAGGTCAGTGATTTGACCAAAGTCAAGCTACAAAACATCCATTATTTTGT
GACAGGACTGAAAGATGAGGTCACAAAGCTTCACTGCGATGAGGAACAGG
GTGAGCAAGAAGCCAGACTCAGGGGCATCCTCAGGTCTGTGGAGCGATGG
GAGGACCTCTGGAAGAAGAGGCTTGCGCTTAAGAGACGAACACAGAGCCG
AGGACATCTTTTCAAAGCCATTAATGAACTGACATCGGTGGAAAAGATGT
TGTCTAAGGTTGAGAGCGAAGTTAGAAACACCGCCTCTAGCTTCATTGTG
GAAGGTTGCTCCTTGGACGAATTCTTCAAGTCACTGTGGAACGTTCAGGA
CAACCAAAGGTCCTGTCTNGTACTTGGGGAGGAGGACAACCTTCGGGCGC
TGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGACCTGACACCAGAC
TCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGACAACCTTCGGGC
GCTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGACCTGACACCAG
ACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGACAACCTTCGG
GCGCTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGACCTGACACC
AGACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGACAACCTTC
GGGCGCTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGACCTGACA
CCAGACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGACAACCT
TCGGGCGCTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGACCTGA
CACCAGACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGACAAC
CTTCGGGCGCTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGACCT
GACACCAGACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGACA
ACCTTCGGGCGCTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAGAC
CTGACACCAGACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGGAGGA
CAACCTTCGGGCACTGCAGACACTTCCTACCCCCACAGCAGCAGCAAAAG
ACCTGACACCAGACTCAGACTCCCAGAGAGAAGTTGTACTTGGGGAGGAG
GACAACCTTCGGGCACTGCAGACACTTCCTACCCCCACAGCAGCAGCAAA
AGACCTGACACCAGACTCAGACTCCCAGAGAGATGTTGTACTTGGGGAGG
AGGACAACCTTCGGGCACTGCAGACACTTCCTACCCCCACAGCAGCAGCA
AAAGGTGAGCATTAA
Gene-mRNA-Prot
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
Blg00414.0Blg00414.0-proteinBranchiostoma lanceolatumpolypeptide
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
Blg00414.0-exon-Sc0000078-1570713199:664632..664680Blg00414.0-exon-Sc0000078-1570713199:664632..664680Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:664808..664884Blg00414.0-exon-Sc0000078-1570713199:664808..664884Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:665907..666071Blg00414.0-exon-Sc0000078-1570713199:665907..666071Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:666444..666593Blg00414.0-exon-Sc0000078-1570713199:666444..666593Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:667248..667356Blg00414.0-exon-Sc0000078-1570713199:667248..667356Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:667749..667831Blg00414.0-exon-Sc0000078-1570713199:667749..667831Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:669964..670038Blg00414.0-exon-Sc0000078-1570713199:669964..670038Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:670424..670525Blg00414.0-exon-Sc0000078-1570713199:670424..670525Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:671670..671745Blg00414.0-exon-Sc0000078-1570713199:671670..671745Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:671996..672097Blg00414.0-exon-Sc0000078-1570713199:671996..672097Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:672348..672449Blg00414.0-exon-Sc0000078-1570713199:672348..672449Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:672700..672801Blg00414.0-exon-Sc0000078-1570713199:672700..672801Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:673052..673153Blg00414.0-exon-Sc0000078-1570713199:673052..673153Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:673404..673505Blg00414.0-exon-Sc0000078-1570713199:673404..673505Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:673756..673857Blg00414.0-exon-Sc0000078-1570713199:673756..673857Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:674108..674209Blg00414.0-exon-Sc0000078-1570713199:674108..674209Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:674454..674555Blg00414.0-exon-Sc0000078-1570713199:674454..674555Branchiostoma lanceolatumexon
Blg00414.0-exon-Sc0000078-1570713199:674800..674912Blg00414.0-exon-Sc0000078-1570713199:674800..674912Branchiostoma lanceolatumexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000078genomeSc0000078:664632..674912 +
Properties
Property NameValue
GeneIDBlg00414