Error message

  • Notice: Undefined variable: cmd in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 28 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 29 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 30 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 31 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 33 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 34 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 35 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 36 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 39 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 40 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 41 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 42 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 45 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 96 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 99 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 106 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined offset: 0 in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 107 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 108 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined variable: prot in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 109 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant transcript - assumed 'transcript' in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 113 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: derives from in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 115 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 413 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Use of undefined constant mRNA - assumed 'mRNA' in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Undefined index: mRNA in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).
  • Notice: Trying to get property of non-object in include() (line 417 of /var/www/marimba/sites/all/themes/sea_theme/tripal_feature_relationships.tpl.php).

Blg00408.7 (mRNA) - B. lanceolatum

Overview
NameBlg00408.7
Unique NameBlg00408.7
TypemRNA
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

mRNA from alignment at Sc0000078:1127149..1152683+

Legend: exonpolypeptideCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Blg00408.7 ID=Blg00408.7|Name=Blg00408.7|organism=Branchiostoma lanceolatum|type=mRNA|length=25535bp|location=Sequence derived from alignment at Sc0000078:1127149..1152683+ (Branchiostoma lanceolatum)
GTCATGGCCGACTTCTGACTTCCTCAGACGGAGTGTTGACAAATTTTCCT CGTGATTTCGAACGGAAAGTTGTCGGTTTCTCTAAACAAGGAGGGAAAGG GTGAGGTACATTTTGCTTCCTACATACTACATATTTTATTGGACTCAGAT TTTGGAAAACGCTAAATTTTGAAGTAACATCCTACCGTGAACTGCACTTA GTAACGTTATCATTACTGTCGGTGATCTGAACAGTTGTAACGTGAGACAT AATTTTGATCCTATAACGTTGTTGACTTTATTAAATTACAGCGAAACGTT TATATTTACGGGTCGAAATCCAAGATTTGAAGGTGGAAGTAGATCTAACT CAAAAAAATTTACTTACTACCGTCAGGCTTTAGAGGCGTAGCTAAATATC CTCCTCCTTGATATCCTGTGTGCGGTCAGCCTGGTTTGTTTAGTTAATGA ATATTATGATGATGATGATGATGAAAATGATAAGAACATTTTGTTGACAG TATCATCAGCGAATTCGCAAACACTTTCTGATGTAATGACAGGCAAGGGT GTACACATTAGAAATCAAAGTTTGTGTATAATTTTATGATTTTCTAGATC TCATTGAAATATTGTAAAGGTTTGGTTACAAACTCCCCCCCCCCCCAGGT AGTGTCACCCCCACAACCCCACCCCACAACACTCCCCTCGTTTGACTTGA GATAGATTCTTCCCAAGGTCACTTCCCCCTATCTGTGTAATCTGACTTTG TATTTGCCGCCGATGCATCAGGACATTTCGCCTTCAAGAGGACACCTAAC TCTAACCTTAATCCTAACCCTAATTTTAACTCAACCCAAATCACAATCTG TATGGCTAAACCCTAACCCTAACTAAGGCCTAACCATAACCTTAAGTAAC ATTAACAATAGTAGAAATTTAGCTACAAACAATGATCTGTAAGGCTTAGA TATGATATACTAATTGTACTGGTGATGGTGACAGACGTCCGAGGTGTGTG TGTGATCTGATACCTCTCGTTACATTTGAATTAATTGTAAGGCGATATAT AATGTAACAGATGTTTGTCTACTAGTAGCACTTTTTTCCTTATGCAGTTA CAAGGATCTTCACCTTGTTTTGCTTTTATGGTCATATTATTAAAATCTAT CTATAAACAATTGCAAGGAGGTTACAATTTTACCTTACTTAATCAAGTAT GATCCATATGTGTGTCCAGGAAATCCATTGTGCTTCTTGTGCAGTTGGAA TTCTTAAAGACCATGCTTGTACTATAAAATCACCCAATAAATTCGGTTAA CATAAACTACCAGGGTCAGTTTGCTACTGACTGCCGTGGTGTTCACATGG GTGGAGGCCTGGCTAAGACAGTCACCACCACCCAAGATACTCTAAAAAAA CTTTTGAAATTTAGAGATAACAGGTAAGGAATTGATGTATGATTATACAT GAAGAAGTTATCTTTATGTAACCCAGAATATAAATGACAACACTGGCTAA AATACCATGCTCTGTTTGGTAGTATAGGTAAAGACATTGGCTGGCAGTTC ATGTGCAGTTCTGCCTTACAAGTTCCACAGAGCTCCAGTCTATATAACTG GCTTTTAGAATACCATGTAGGTACCACAGCTGCAAGTCATACTTGTAGAC ACACAACTATCAGACATTTGAATTCAACTGTGAGGAGGGCATTTCCAAGT TGCAATTATACAGTTAGACACTTTGAAACAACTTTGACAGGCTGATTTGA AAGTTTTTATTTGAACACAAGGTTGATTTTCTAAAAACTGAAAGTTATTT TATGAAGCGAACGAGGTTGTTTTATGAGGTTGTTATAGCACATGACTAGG CGNAATTAAGGGTTAATGACCCGCCCCGAGGTGTATATGGTGTCATAACG CCTGGCCATGTGCTATAACCACCGAATAAAACCACCGAGTGAGCGAAGCG AACGAGGTGGTTTTATGAGGTGGTTATAGCACATGACCAGGCGTTATGAC ACCATATACACCGAGGAAGAGGCGGGTCATTAACGTTATTATCATATAGC TTATCCAAACTGACGCATATAAGAGTAGACAATTTCTGTTTGACGCATAG ATCCCTTATACTATTAAGAATGCATTTCAGAATTCACATTTGTCCTTTAT TAACAGAAGATGATGAAGAATATGTACAACTGTTGCCTGATTTATTTATT TCAACCACACAGGATAGGAGGGTCGGTTTCAGGTCAGTCAGAAAATGTTA TCATTGAAGAATCTCCCTGCAACATGACCTCAGATAAACCTGAATAGAAC ACAGGTTCTTTGGCCAGCAGGAAATGGAACGCGCGGAACCTTAGATAGAA CGTGGTTTCTTTGGCCAACAGCAAATGGAACACGCAGAACATTTTTGGGA ATTTTAAATTTGTTTTCCCTTTTTCATGTATTCTAAGGAATTTTTAGGAA TTCTAAGACAATAAAGATTTTTTTAAACAAGGTTAAGAAAAAGATTCATC AAATAGATACCCCCTCTACAAAATGCAACGTTTATAAAGATTTTCTAAAC AAGGTTAAGAAAAGGATTCATCAAAAAGATACCCCCTCTGCAAAATGGAA CGGTTGTGTTCTGACATGACGTCAATAAGTGGTGTGTTATGGCGTGATAA CAGACCACTTATTGTGGGCAATGGTGGCTTCTGATTGGTCGACGCCATCT ACCTATGTGATAATGTTACTTTGAAAACCAGTAGAAAAAAATATTTGAAT CTTGTTCACCAGTATTATGCTAATCTTCTCCTGCCTTTGTTTCAAGCTGG AGTCAGTCTGGGATTTTTATGTGTTTATGTAGTTATGGGGGCCAATCCAC CTTTCAAACTGCAGCAAGGCCACAGTGGGAAGCACTTCCTGAATCAGTTT ATGGTTCTGGCCCCAGGGTTCAGAAAAAGGATTTTTAAGTAATTATAACA AAAAGCAAGATGGTAAGATTTATTCTGTAATGTAATAACAGTTGAGCCTT TTGTAGTATAATACCCAAATGTCCAATTTATTTGATCCAAACAGCCAAGA CATTGACAGGATGAAATTACTTTGTTAAACCCTGCAAGCCTACATGTAGA TCAAATTGGTAAAATGCCCTTGTTGTATGTTGAGATTTTGGTTGTTAAAT TATTGTTATATGTGTTTTTACTCTAAGTTCAAATAAATTTTTATGCGAGG ATAAACAACATTGTGCCGTGGATAATTCATTACTTTTGTATTATTTTCAT TCATCTAACTGCTAAACACAGCTTACAACATACAATTCATTATCACAGTA AGGGGCCCGGGAATTCTGAGCAACGAGTACATTTAACAGTCAATCCATAA TTACCGCAGATATTAATGTGTCATTGTCTGCTGTTATCAACAGAATATTG TTGTTGGATATAAGACTTCACAGTCCACAGGTTACAACTTTGCACATCTA GTATATTCCACTATATAGTATACCATAAGTATGTTTTTTCAGTCAGGTAT TCTCATGTTATACGTCACTAAGGACTGAGTTGTAGAAGGGCTCGTAAGTG TCCATCTAAGACCATGCCTCGCCCCGTGCCCTTTGGCCAGCAAACAGTGT GATCTCTCTGATCAAATAGATATGGGGAAAATGGTTGATAAGCCACAGAA AAGCTTCCCTATGCATTATATTTAATTGATTATCTTTTATGTGTATTTGA ATTAAAATCAAAATAGTTTTTTCATCTAAGTTGTAAATAATAAAAACACT TCTTAATTATGTTTGACAATATTATTACAAAGTTATCAATGCATCTTCAA ACTCCAGCCTGTTTGCAAACTCTTGCAGTGTTGTTTATATATTCATGAAT GAATACTGAGTTTGTAGGTCAAGAGATCTTGCACCACATTGCTGATTTAT ACTAGAGTAGAGTAGAGTCTTAATTCAGGTAGGATGCTTTACATCCAGTT TAGACCGCTCCCTTGTACCACTTCTTTAGCTGACTGACACTGGGTTTCTG TGGGTGGTCCAGGGCTCTGAAGTTGTATTTTACAGGATGGCTTTCCATAA GGTGGTCAAACCTGGCTTTAAAAGCTTTATACTGGGCATGTTATAATTAC AAAAAGGTGATAGCTTGTTGAAATATTCTAATCATTGAGCAATGTGAATT TACACTTATTACAAAGTACCAGCATCAGTTATAGTTCCAATTTGGAGACC TGATCATGAGGTACATGAACAATGTACTGAATTACTGTTCAAAGTCAATC GTTTAGTAATGTTGTGCTGTATATATACACGTACATGTATATCAATGCCC TACTAAGTACTAGTACTACATGTAGTAGTACATGTATGTATATTGACAGG AGACAGTTACTCTCATCTCCCAAATAAACATACCCCCCGGAATAAACATA CCCCCTGGACAAATCTTCAAAATCTAATAAACGTACCCCCCGGAATAAAC ATACCCCCCGGAAATTGACCAAATTTACAGATAAACTGTGTCCATGCTAC TTCTGTCCGAGGGAAAGAAGATGATTAGCAGGTTCTCTTTATTCATTTAT TGACTATTTATGCCTGTCTGAGGACCATACCAATTAAGTGTATAACTATT GAACAGAATAACTGTACACATCTTGTTCAAATTATAATATTCCTTGCCAC TTCAAAAAGATATACTGTAGTAGCAATGTTGAAAAAATTGGGCATAGGTT CCCCGCTATGACCCCTAACCGGGGGCCAACGGTGCTTCAAATTCAACAAG TTAAAATGTACATGATCATTGATGATTGCATTTTCTGCTTGGAACTTGAA GCAAGTAAATTGTTGTATATACTGACATATAATCAAAACATGAAAAGTAG TCGCCAAACTTCTCAGTTCACTTGGATGGGCAACACTTTGAAAGTCTACT CTTTTTCTATACAAATGTATCAACATTTAGAAGATGAACAGAAAATTACA ATATCCTGAATATATTGTCATCACAGGTATTACTTATATTTTGTAAAAGT CATGATAGAGAAAAGGAAGACTATGACAATCACATCATTTTTTTCACATG TATATGATGTAACTAGTTGTCTTTCCCAACTTGCCATTTATCTTCTATGC CTTCCATATAGAAACATATATTTNGATGTAACTTTTTGTCTTTCCCAACT TGCCATTTATCTTCTATGCCTTCCATATAGAAACATAGATTTGTAAACAT TACATGCCACAAATCATTGTGTTGTGTCAAGGACATTTAATATCATATAA TATCAAAGACAATATTATATAATGTTCTTGGCTTTTGTTGTTGCAATCCA AATAATTTAAAATCTAAAAATTACCCTTGTATGTATCATTTTGAGAAACT AAATTGTCAACAAATTTGTGAGAAACCTCCTGAAGGCTTGTTACAATGTT GCCACAAACTACAGGGTTCTCATGTTACATGAAAGGGTGAGCTATAGACA GTGGCGGCGCCACAGACAGAAAGGGGCGGGGCTAACAGAACGTACACTCA TGTTCTTAGAAACCTCCGGCATTCTTTCTGTAGGGGGGTGATCTTTTTTC AAGCATTTTTCAGTGATAAAAATGGTGACTAGATTGCAACAATTTTTTTA TATAGACTAAGGTATTTAAAGTATTTTTGTAAAACTGCAAAATACATTTC TGACAAAGGCAAAGGAGTTTTATTTGTAGATCAAAGAGACGTGTTTCCCC TTCTTGAGAGTGAGATCTTCCAAAACAAAACATTCCCACCGACTGTCACT GCCGGGTGCGTTACTGTGGCGCTTTTCGAAGGGCAAAATTATCATGTTTG CGGTAGGATTGAAATGTTTTGATATACTTTCAAAGTAATGATAAAGTTTT TGATCCTAAGACACAGTTTTTTGTGGTGTTATTNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNACTGTAGTCAGCATAACTCAAGAA CCTCTTGATGGATTACAATGATATTTGGGATGTGGGCGGGTGTTGTAAAG CCGAAATTTAAGGTCGATTTTGGGCCCCCTGGTATGTGACCTTGGTACTG CAGCAGAACTTCAATTTTTGTATCTTTTGACCTGGACGTGCTGTGGTCTT GATTTTTGGGTGGCAGATAGCTTGTGATGTAATAAAGAAGTGGTGTAGGT TTGGGCCCCCTAGCAGCTTCCTCTGGAACTGCAGGGGCGTTTTTGTGAAA ATCTTCTAAGGAGAATAACTGAACAAAGGAACAACGGATTTCCATGATAT TTAGTATGCAGGTAGCTTAGATAGAGATATACACAATGAAGTGCAAATTA TGCTAATTGGGACTTAATTTGCATAGCTAATGAGGAAAATCTATATTTGC AGTGTTTTCCATTATCAGACGCAAATACATGTAACGTATGTAGTTTATGG AAAGTGGATCATCAACAGATACCAATTATGCAAATAAATTCCTAATTTGC ATAATCAATGCAAAACACCATATCTCGTCTAATTGGAAAATTATAGGACT GTCAATATGATACTTAGTATGCAGGTAGCTTAGACAGAGATATACATAAT GAAGTGCAAATTATGCTAATTGGGACTTAATTTGCATAGCTAATGAGGAA AATCTATATTTGCAGTGTTTTCCATTATCAGACTCAAATACATGTAACGT ATGTAGTTTATGGAAAGTGGATCATCAACAGATACCAATTATGCAAATAA ATTCCTAATTTGCATAATTAATGCAAAACACCATATCTCATCTAATTGGA AAATTATAGGACTGTCAATATGATACTTAGTATGCAGGTAGCTTAGACAG AGATATACATAATGAAGTGCAAATTATGCTAATTGGGACTTAATTTGCAT AGCTAATGAGGAAAATCCATATTTACAGTGTTTTCCATTATCAGACTCAA ATACATGTCACATATGTAGTTTATGGAAAGTGGAGCATCAACAGATACCA ATTATGCAAATAAATTCCTAATTTGCATAATTAATGCAAAACACCATATC TCATCTAATTGGAAAATTATAGGACTGTCAATATGATACTTAGTATGCAG GTAGCTTAGACAGAGATATACATAATGAAGTGCAAATTATGCTAATTGTG ACTTAATTTGCATAGCTAATGAGGAAAATCTATATTTGCAGTGTTTTCCA TTATCAGACTCAAATACATGTAACATATGTAGTTTATGGAAAGTGGAGCA TCAACAGATACCAATTATGCAAATAAATTCCTAATTTGCATAATTAATGC AAAAACACCATAATTCATCTAATTGGAAAATTATAGGACTGTCAATATTG CAACATGTGTAAGTTAGATAAAGGTGTTTATGACCAAGCATATATTATGC AAATGTGTAAGTCATTTGCATGAATAGAATTGTTCATGGAGATATGAGGT CGTGGAACTCTTGTTTTTATATTTTCATTTTGGGAAAGACTGTATCTCAT CACGTGAGTAGAGTAATGTATTACATGCGTAACGTTACTTGAAACACTTT GCGCCACTGACAGATATTGGTTTCTGGTCAGCATGCTTTGGTTTACGATG TTATGAGACTGCTAAAGTTGTTCATATAAAAAGAACAGCATTTCAAAACG TCAGTGTGGCGTCTTATTTTTGCCCAATAACAACGTTGACTTTGAAGTGT TATAGAGATCGACCGATACGTTACGAGTTCCGCCAGGATTTCACAAAGAC CGGGTCATAGCAGCAGGGAAATCAACGCCGCTTGGCCGGAAAATAATGAA TTATGAGCAAAAATGCCGGGGAAATATTGGCAGGAAAACCCAAACTTTGA ATTTTAAGAGGATCCCAGGTTAGCAAAACTCAAATTTTCAAAAAAATAAT AAACGTACCGTCCAAAATAAGAACGTACTGGGTGGATTTTGAGGCTGAAA AAAATAAACGTACCGGTACGTTTATTTGGGAGATGAGAGTAGCAAGATGG TCTTGTAGTTGCGGTTATTATCTCCATGAAAAATGGAGATATAGTTTTGG GTGTGTCTGTGTGTTTGCTTGTCTGTTTGTTTGTGTTTCTGGACTACTGT AGTCAGCATAACTCAAGAACCGCTTGATGGATTACGATGATATTTGGTAT GTGGGCAGGTGTTGTGAAGCCGAAATTCAAGGTCGATTTTGGGCCCCCTG GTATGTGACCTTGGTACTGCAGCAGAAATTCCATTTTTGTATCTCTTGAC CTGGACGTGCTATGGTCTTGATTTTTTGGTGGCAGATAGCTTGTGGTGTA ATGAAGACGTGGTGTGGGTTTGGCCCCCCTAGCAGCTTCCTCTGGAACTG CAGGGGCGTTTTTGTGAAAATCTTCAAAGGAGAATAACTGAACAAAGGAA CAACGGATTTCCATGATATTTAGTATGCAGGTAGCTTAGACAGAGATATA CACAATGAAGTGCAAATTATGCTAATTGGGACTTAATTTGCATAGCTAAT GAGGAAAATCTATATTTGCAGTGTTTTCCATTATCAGACTCAAATACATG TAACGTATGTAGTTTATGGAAAGTGGATCATCAACAGATACCAATTATGC AAATAAATTCCTAATTTGCATAATTAATTCAAAACACCATTTCTCACCTA ATTGGAAAATTATAGGACTGTCAATATGGTTCTTAGTATGAAGGTAGCTT AGACAGAGATATACGTAATGAAGTGCAAATTATGCCAATTGTGACTTAAT TTGCATAGCTAATGAGGAAAATCTATATTTGCAGTGTTTTCCTTTATCAG ACTCAAATACATGTAACATATGTAGTTTATGGAAAGTGGAGCATCAACAG ATACCAATTATGCAAATAGATTCCTACTTTGCATAATTAATGCAAAAACA CCATAATTCATCTAATTGGAAAATTATAGGACTGTTAATATTGCAACATG TGTAAGTTAGATAAATGTGTTTATGACCAAGCATATATTATGCAAATGTG TAAGTCATTTGCATGAATAGAATTGTTCATGGAGATATGAGGTCGTGGAA CTCTTGTTGACTAAGAATCTACATGTTCTACATGTACTAGTAGGTTCAAA TCCCTGGCAGGCCCCTGTGTTAAGCCCTTGGGAATGGCATTTTACTCTTA ATATATTTCCTCAACTCACTCGGGAGAAAATGAATAGTACCTATAACTTT AATGTATTGATAGGGATGTCCTCTTAGAAAATGGGAGTAAAGCTGGAGGT CCAATGTTTGAGGAGAACCGTACCTGTAGCACATTTAAAAAAAAACACCA CAATTCACAAAAAGAGGGATCCTTCGGGTTGTGAGTGAATCAAACCTTAC AGTCTGGTCTCCGGGTTGACATCTTGAAAAGGTAATAGTCACCTGTCATG TCAATCATTCCACAAATGTCAGTAGACAAACAGATAAGTATACTGTAGGT ATGATTTTTATTGTAACAGTTATACATGTACAAATGTTATATCATTTTCT CGCAGATTCAGAAGATGAGCAGGGGAGAGTTTGGTGCGTATGGGTCTGTG GAGACAGGTGGTTTTGACCGGAGAGACGACGGGTACGGTGTACCCAGGAG AGCCGGTTACCAGGAGGATGGCTCTAACGATGTCAACCGTCTGTGTGAGC TGACGAGCACTAACATATTCACCATCTCCAACAATGGTGGGTCTTGTGTT GTTACCTTTGCCAGAAAGGTATATTTTGGGTAGCATTGGTGCGTGTGTGT CTGTGTGTGTGCCCTCACGAAGGCCTACTTTTTTCCAAAAGTGTGAACAA GTCCTGTGTGCACATGTCCTAGGCAGTCTAATACCACATTTGGTATAAAT GCTAGGGCACCTAAGCCAGAAATGTAAGGTAAATTGATTAGTAGAATCGG ACAATCAGGCCCTTACATTTCTAAACGTATCACTCCCATTGGCCATCACT TCCAATTGGAAGTGAAAGAAGCGGCAAAATAATGCCAAAAAAGCCCAAAA TGCTTTTAAAGAAGTGTACGCCAAAAATGTAAATGTGGTCCTTTGACCAT TTGTTCAAGGCACATCCACACCAAATTTCAGGTCAATTTGTTTGAATACC GGGACACAGGAGGCCAAAATGTACATTTCTCGTTTAGAATGGCCAAAAAT ATCTCCATAAAATCTCTTTAAAGACCTGTATCAGAATTTTTGAAAAAAGA AACATAAACAACCTGGGGGTATGTACCCACTCTTCCAGTATACCAAATTT TAGCTCATTTGGCCCTGGAGGGACTACTGAGATGAATCCCTTTGAAGTTT GAGGATTTGACTGGAGAAGAAAGAGGAGGAGAAAGAAACATGACCAAAAA CAATATATTTCAACCAAACCGTAGTATGGGTGAAATATAATTATATATCT ACTACTATTTTTGTGTACAAACTCTAGTCGCCATCCCAGCAATGGTCACC GTGGTTCATGGTTTATTGTCATGGCACTGCAGTTTATACTTGAGTCAACA GGGGGCAGCTGTGCACTACAGAGGAATACATGTAGATTTTTGCTTACAAA CTCTAGAATCTAAAAGTTTGGAAAACAGGATCTGTAGTCCTGAAACTTTG AACCAGCTGAAATTTAAGTATCAGTTTATGTGAGTCTGACTCAGTGAATC AAGTAGTTCCTGTACTAAGTATGATAATAATTATGTTAAGTGCATATAGA CCTTAGGTTGGAGGAACAACAACTCCTTGTCTAACTCTGTTACTTGTGTC TTCCCAGCCTCCTCCTTGGAGAAGACCCTGAAGCAGATCGGTTCAGCCAA TGACAGCCATCAGCTCAGGGACAGAGTGTAAGTCAGATGACATGTGTCTA AGTCTGGCAGTGAAACACAGTGATATTTGTTTGTTGAATTGAGTTGATAA ATTTTGAGATAAGATAGGTCTCCTTGTTTATTGGAGTGCAGGGTGCGAAA TACTTTTTTGAGCCAGGTTGCCCATGTTGCAACCAAGGGCAAATGCTAGG TTGCACATCCAAATTTCAGGTTGCTCCAGCAACATTCACCGATTTCTTCA AATCAAGCTCGTATGTAGCGTATAATACTACTAACATTTCGAAATATATA TTAGATAGTATTGTGTTCCCATTGACCTAACAACATCTTGTTTAGCTGAG GGCAGTGTGTTTTTGTCTTTTTCAGCTCAAATTCCACGATCTATGAAGGG TTTTGGATGGTTTAAAACGAAAAAGTGTTGATTTCTTTATTTCAATTGAA GATTTACCGAATTTTATGAGAGTGACACTGTGTTTTTGTGAGCTTCCAGG GCTCCGATTGAAATCTTTGGCTCAAAATATAAGGTTGCACACTGCGCTGC CTGGGTTTGGAATTAACTTGCACCAACCAAAATCTTGTTGCACTGAGTCT GTGCAACGTGCAACCAGGTATTTCGCACCCTGGAGTGTGATAATTTATAA CTTCTGAGCCATATTGAGTAGTGTAGAATCCTGATTTAGTATTTATGGCA GCAAGATATGACATTTCTTACAAGAATAGATTAAGCTATCTGCTAGTTGG GCATACTTGGCTCGGCCATGTAACCATGTATTCATTCCATACCAATATAT AGATATTAAGTGAATTGAACATAATCATTATTTTGCACCAAACAAACACC CGTCTGCAGACAAAGCAAATTCATGTGTTGTGATATCTTTCAGTTATTCA GTTATTGTAATCAAGATGATTAAGCACTGTTTAATAATCAAATAGCTTTT CTCGCAAGCCATGGTGCCAGGATCTGAACTGACATGATATGACATCACCT CAGCTATACCGTATAGTTCTATAATTATTCGGCATGAAGAATAAAAAGCT GGAAGTAGGATTTTTCAGTGGTTTGTTCAATACCGTCAGATTGAAGGGTG TTTCTTTGATATACAACATGTAAATGGTTATGTTCATTGAATTTTACTAT CCTTCGTAGAGATAATAAAAACATGACTTGTTTTATTTTGGTGTCATACT TATAAACAAGCATACTTTACCCGAGCACACTGTTCCATACATTTAACACA CTGACTCTTCTACAGCCACACCATGCAGCAGCAGACTAACCTGTTAGTGA GTGAGACTGCCAGGTGTCTGAAGCAGCTGTCACAGATGACAAGGGGGGCT CCGAAGGTAGCTTAGAGCTATAATTGATCCATTGTGACATTTTAAGGTTT TGCATTATTACCCAAATGTAAGTCTGACTGATTGACTACAATAGATTTGT AGGTAGATCCTCATATACAGCTCTCATTTCAGATTATTGAAGGCAAAGAA TTGCTAGAATTCAACTGTATATGTCAACATTCAAAATATACTGGCATGAT TCCCTTGCTACATGTAATTGCCTGTTACCTGTAATAAAAGTTTATCCCTT TTTAACGGACAAATACATTTTAGATGGTAACATATATTTATACATTTCTT TCCTTTTCTTCACAGCCACAGAAGCTACAAGTGGACAGACTAAGTAATGA GTTTAAGCAGAGTGTACAGAGATATGGCATCATTCAGAAGGTACCGTATT GTTATATAAAGGATCTGTTGAATAAGTGTAAGGTTTGAACAAACACTGTT TCAGTATAAAATGCATAAAATGTAACTGCTCATTTACTGTAAATTCATTT ACTTTTGCATTGGTTTTTATTTCACAGCAGGAGGGAAAAGGAAGTTTTAC ATTTGCAGTTAAAACAATACTGTTAGTAACTGTTAGTAAGACATTGGAAA CACATACACTCGTGTCATTGATTTGTGGAGGTCACAAAACCACCACGAAA GTTTCAAGATTTGCAGTAAGAAAGTGAAGTATTTCTGTACTGCTAAATTT TGGGAACTACGGTAATTTTCCCTAGCAGGACATGAGACAAATCTAGAATA CTTGTTGTAAGTTATTTGATCATCCCAGTGGCAGCAATGTGATTTTTAGA CATTACAATGTTTTTTCCTCCTTCCTGGCAAACAGAGAGTAGCAGAGCAG TCCAGAATGAGTGTAGACACCATTAGGAGTCCCAGCAGGGCTTCACAGGT GACTCTTTCATCTATCATCAGTGCCCCCTAGTGAAATGTTTATGCATAGC AACTGTTAGTAGCATTTGGTAAATGCATGGAACACTGCAAAATGGTGAAA ATTAAACTTTCAAGAAGCTATACTTAACTTTGAAATGTTATAGTGTCATA CTTAAGATGTTGATGCTTCCATGTAAATGTATAACATTCTTTTATTTCCA TTCCTGCACACTTTGGACAATGAAACAAACTGGCAGCGGGGAAGAAAGGT ATTTCAAGGCTAGAGAATTTATTTAAAAGATTTAACTGCTGGTGGAAGGT CTAGTTTTGCCCGAGGCAATTATTATCATGCTCAATTGCTCAGTTGGCTA GTGTTAGTTGAATGTAGCTGCCCTTGATAATTACAATGTATATCACACAT CTACACATGTAGCTAGATTTGAAGAGCAATACTGAAGACAGTTATGAAGA CATCATAGAGAGACTTAATAATGATATGATATAGAAAGCATTCAATATAC ATCTAAACAGGATCACTGTTTGTGAGACAAATCTTTAAAAATTAATGTTT TCAAGCTTATATTTTCCTCAACCTTCAGCCTGCTGTTTGTTACCAAATTT GTATTAGTTTTGGGGTAGGCGGCAGAAAAACTGCACGCAAACAAAACGAA ACAAAAGCTGCATTTAGTGGTGNAATTTGTATTAGTTTTGGGGTAGGCAG CAGAAAAACTGCACGCAAACAAAACGGAACAAAAGCTGCATTTATAGGTG GCGTATTATGGTGTAGGGTGGTTATAGATTGTACCAGCCATACAGATACA GAAGATTGTACGGAACATTGTATGAGGTCTATACATTACAGTCAGTATGT CCTCGTGAACCTCCACTTCTGATACGCTTACGCAGGATGGAGCATTAAAT GATGGCCACAATATCAATAAACAATGTCAACAGAAGTTCTAAATGTACCC CCGGGTAATCACCAAGTCATTCAGTCCTAAAGTCAAGCAATAAAATGGTT CTGTGCGGACGATAAAACAGGGAAACTGCCAACTACACAGAAATTTTAGT GTGGAGGTAAACTGCGTACAGAGAATTGGATGTTACGGATAGCACATTGC CTTTTGACTACAGTCTGACTACAGAAGTGTCCGCAGCAAGCAAGCGGTTT TGACCTTTGTTTAGATTGTCCATGATGGTTAGTATTGCTAATCTCTATTA TGATTACTCACCTGGTCTAGGCAATATTAGAATGGTAGATNTGTTTCTGC TTGTGCTAAGAGCAAACTTTGAGGAAAATATCGCCATCAGTCCACTATCA CACACAACATTTAGACAAAAAAGTGTTCCTCGCAAACGTTTGTCGTCTGC CGAATAGCAGGATTCTGGGTAACGAATATGGCGGCGGGAAAATTCACCGT AGTGCCGTAGCCATTGGTTGTAGCAACAAAGAGGCGTTTTGATGATTAAT CACACTTAGAGTCCAGTTGTAGGTTAGCAAAAGAGATTCTAATAAGTTGT ATTGTAAATAATTGTGTTTAGCAGGAAGCGGATGTGACATTTGTCTTATA AACCAGCGAACAACTATGTACATATAATTCTCCCACGAAGCCCTCAGACT GTGACAATAAGGGACGGAGAGTTTTTGACGTCGCCAACTTCTAATGCATG GTTATCGAAGCTTTTCAGACAGTGTTCTGAATGCGTTAGTCTGTCAAGTT TGCATTTCTAGCGGTATTACTGATGTTGCATCTAGCACATATCCCTAAAC ACCCCGTTTTCGAAAAATCCCGAATTTAAGTACCCCGCGAATTTATGTTA CCCAACGTTATATCTAATACCAACTCAGAAAAGAGCCATGCCTTCAAGTA CCAGTTATTAACCTAGGATAGATGTGTTCAAATATTTGTTTTCCCTAGAA CTATCATAGCTTGGAACTTTTTGCCACCAAGTGCAGTAGGGGCATCCTCA TTAGATAGCTTAGTTTAAACAATGCTTACAGCTAGATGTGCAAACTAAGG TTTTGACAGGAACTGGTGTAATATTATCAATAACCAGTAACNTATCAATA ACCGGTAACTGTTGCTGCGATACAGCATGCCTGCAAAGCTGGTGTACTAC ATAAAATTTGGTTATACCAGATACAAATGCAGATGAAATTCATGTAATAC TGTGACTGTCCTAATAAGCCATTTGCAGGAATAATACCCTCAGCCTTTCC CTGTAATCACTAGTAAACGATAAAGTTAATGCACACTATTTACCCAGTAA TATTCAATCTCACTTAACTGTTTCAAGCAATGAAATCAAGCAAGAAGTGA TATCGTCAGCACCCGTATGCTTTTAGATATGGGGAAGACTATGTAGGATC TTGAAATAGAAATTGATTAAAGAAAAAGACAAACAAGTGCATTTCGAGTG TTGCCTCAAGATGTACATTGTATCAGACTTGCTCAAGGAAATGACAACTA GACGTTAACTGCTGCTGATTTCTCAAACACAAGTCAAAAATATATTCCCC TTTCATCTACCCTAAGGGAAAAATTTGTCTGATTCTTAACTAACACAGTT GACTGTAAATTTAATGTTGTCGCCTGGAGCTGTGTGTACCATAATAGCTT ACCGGGAACATCTGCACCTTAATTCAAGACACAGCCAGTACAGTATCTAG CCTTGAGGTTTTAACCTTGCCAATGGGATTGTGTGTTCTCTTAATTTGTC ACCTTCACATGTACATTTACATTGTTACAGTAGTATTACAGTTTACTACT TTTTTGCCTAAGAGCTAGAAGTTATAAAGGGATCAAATATGGTTTTGTTA TTTGCCCTCCTTCTGCCTAGGGAGGTTATAAAAATTGTTAGTGGTGGGCT AAAGGCAAAGTGTTGATGAGCAGTTCATGTCTGCCATCAAGCCCCCCCTC CATCCATTCTCCGTGTTGAATGGCCTGCATGGCTGTACTTTGGCAGGAGC AGACGTAGATTATGTTTCCATGTTGAAAAGTTGACAGTTTTACATGTAGA TTGACTGATATTTATGCGCAGACGACAGTAGTTGAAGCCGTGTGGTATTA ATCTGTGTGAACCTCGGCAGGGTTTCCTGGATGATGACTATGGAGACGAG TCCACCAGTCTGCTGGAGGAGGAGCAGCAGCGCAGGAGGGTGGAGGAGCT GCAGAGGCAGGAACAGGTCATCGACTTCGAGGGGGACATCATCAGGGAGA GGGAGGAGAGAATACGGGAAATCGAGGTACACAATGGCAAAACAGAAGCT TTACATTGTTTCGAATTGATTAAAACACAATGTAAGACCACACACTATAC ATTACACTCAAACGTTCAATGTATCATTGCCTACCTGTGCACAGGTTTTG TTTTCAGGGAGTCTGGATGTTAGTGTGCTTTGTGCTCATACTGTAAAAAA ATAATGCATTTAAGTTCGCATGGTTTTTATTCGCGCTAAGGCAAAAATGG AGTGTTCGCGGTGGTTTTAAGTTCGGGACAATGCCATAGTTACAAACCGC TACAGAATTGGACAAAAATATTTGCGGTTGTTTTAGATTCGCTGTTAAAC GGTTGCCGCGAAATCGCAAACATAAAACCACCGCAAACATTTCTGCATTT ACAGTAGTACTGTTATTTCAATACAGAGGTGTAATAGGAAGTGGGGGATG CTAGGCATGTAAGAACACTGACAGGAAGTTAGGTCAAAGGTCCCAGAAAG GTCCCCAAAAAGGTTTCAATTCCCTACTTCTTTGTGCATATTATGCATAT GCATGTCTGTTGCCTTATGAGTAGAAAATGCATTAGACAGAATCAGTGAG AAATTCACAATAATGAATAAAACAGGAAATTCACAGAAACTGAAAATATT CAGTGGAGGCGTGAGATCTTTGATAGAAGTTTCTTGTCGACTTCTGAAAG ATGAAGTTTGTTGGATCTTTGTGCTAATAGTATGCAAATCAAAGTTAACT AATATCTAACATGGAGAGGTTTGAAAAATAGTAAGACTAAGAGTTTAATT TGGTTCTAATCAGCTAAAACTGCTTATGTCCACTATACCAGGAGGGTTGG TCTTGAGCAATGTGCCAAAATCTCTGATCAACAGCTCTACCAAAGCCGTA TCTACAATGTGTGGTTCATGATAAAATTTATCTGAAAAGTTTCTCTCGGG AGGAGTTGAGAACTCACAGACCTACTCCTGTGTATCTGCTGTGCAAAGTA ATGAGAACTGAGGTGATCCCATCTGTCATCATCACCCCCTCTGGGGGTTT CAGCTTGCATTCTTGTATTGACTTTATTTGCAAGGACTTGTCCATTAATC ACCTTTACCCCCTGAAGACATCCCGTTCTATCTTAATGATTGTGCATCAT ACGTTACATACAGGTATACGAAGAAATAAATCAACAGTCTTAAATGGGAT AGGATAATGTTGAATAACAATATCATTTAGCTTTAGGAAAACAAAATTAA TGTAGACAATGGTTTCAGTGAGAGCTTTTTCCTTTAAATGAATGTAACCT TTCTCACCAAGCTACAGTTTGAAGAACTTAAATGTGCCAATGATATACAC CTCATCACCTACATGTAGCAAAATGTTTCCATCAATGATTCTTCTTTAAA TTTGGACATGCATGCGGTCAATCAGAGATAGAGGTGCTTAGGGTCCTAAA GAAGAAAGATACAATGTATCTGTTTCCCTGAAACAACATCAGACAAGCAA GTCTGGAGATAATATTGATCTGAGGGCTTGAAATAGATTTCTCTGATGGA ATAGTAGACAGTTCTGACTGAAAGCCGTTAAGAAACCGCAAATAGTTCTT TTAGCGCGATTTCACAGCCAGTTACGTTTTAATTGGAACAGCAAAGAAAA GGCGTAATATATATATATACCCAGTGCATTGATTGGCGCTGGTTACATGT AGGTGCAGGTAGACCCTGCAGTCTCATGCCCGGGTCTAGGCACAACTGGT ACCCATGCCATGTACATGTGTATGAGGGAGCTCATGGTGTCAAACCTCTG CATGTAAAACAACCCAACACTGTGACTTATTGAGAAGAGTAGCGGTGACC TGGTGTGCTTGGCAGAATATGCGAGAAGCAGCAAAGCAAAGAACTTAGAC TGGCTAAAGCTTATCATAAGCTAAAGGAAAAGCACCATGCCTTGTCCGGA CGTTCTCAGTCTGAGTGCTTTACATTTTTTTACACATTAAGAATACTGTT TATTATACAGTCACATTCAAGTCCAATTTTCCTCGCACTAGCTATATTCT AACCTGCACATGTAGGTGGTATGATGAGCCCTGGTTGATGAATAAAGGGT TGAATATACATGAATTTTGTCATGTACATTTCACAGCAATTAAATCACTG AGAGATGTTGGATACTCATCAGAGCTTCTCTATCGTTCTGTTCCAATAAT TGTATTCCAAAGTCATTAGAAACCTGTAATTTGAAGAGAGTCATGTTGGT AGAGAAAGAATTCTCATGAGAAGATCTGTTCTTAGCGGATACATGAGTGC CAGCCTTAATTGTGTAACCTGGGGGTGTCTGAATGTCTTGGGTTACTGAT TGATCAATTTTTATGTTCCCTTCAGGCAGGGATTTTCATTGTCTTCTTGT TCCTTTTCATCATCTTCAGATGGAAAATAATCACAGTAACTACAAAAGAG AACATGCCTGTCAGTCATAAAGATTGACCTACATGTACATGTATATGGTA CATGGTGATTCCACTGGATAGTTATACCCCCCCCCCTTCTACACATACAT GTACATGTGCAGACTAATAGTAATAGAGACCCTCACTACTGTCAATCTTG AAAATTTTGAGTTTTTTTGTGTCAGTGAATATCCCCCAAAAAATTCTTGA CACCACGCATATATTGTTACGTGTCCCTTGTATGCCCACTTCACTACAAA ATTGTTTCAATCTTGACTATAAAACACGGCAAAACCTCCTTTTTCCTTTT ACCGCAAAATGAAACACCTGCAAAAGTGAATGGACCCTATCCACCGCTTT TGATACCATTATGAAAACAATTAGCAATACTCGTATGAATGATAATTGAA TTCATTGCTCTGATGCAGTTCAATAGAGAAAGAGACATACAAAGCTCACG CTGTCCTAACTGACTAAGTTTGAGATGTTTAACCTGACATAAGCTGGACG GTGAGTGATCATGAGTGTGAGTGAACCGTCACAATAATTGGCTGTCCTTG TTGGAAGGAAGTAAGCTGTTTGTGAACAGTGGTGGAAATAAGCACCCTTT TAGACTACATTTGTAGGTTTAGATCATTGTAATAAAATGACCTTGCAGTG ATAAGTACAGGAGGTGGTTTTGGCATAAAGAAAGGCTTAGGACACATGTG CTCTTTCCTTTCACATCTCTGTGAAATGCTCATTGACAAGTCTTCTTGCC ACGCCTGCAACGTTGGTAGAAAATTCTGGATGAAATATATGGTCATACCA ACATACCCTCTGGCAAGTCAAAAGAAATAGTTCTCTTCATGGATCTATCC ACCATGACAGTACTGATTTATGTTTGCTTACTAGATGTTCTGTTTTCATC CTTTCAATGCAAACAATTCTTCACAGGCTCAGGTAGCTCTACAGGCTCAG CGTGAACACCCACATTAGCGCCAGCATTCTGTTACAGGGGTAATCCTGGC GTAAATCATGAATTCATACGCTATTCTTACGTGTAGATACAAACCATATA CATGTAATAGAAGGGGTACCAGACTGAGTGTTATTGAATACTGTGAGTCA TGGTATGGTGGAGTTTCTTTGAGCTAGCAGAGCTGGTCATCTAAACCACG GTCAAAAATGAGAAAAGAAATACAATGTCATGATTGTGTAATCTGGAACA TAAAAGTTGACAGTTTTCTCTTTTTTGGACACCTAAGCAAAAATGTGGAA AATTAAAGAAATGTGTTTTAAACATGGGGGAAGGAAATATTTGATACATG TATGAAGTGCAAATGCTACCGTTCAAGCACTCATTCTGAAACACTACTGA TAAAGGACAATTATTTAACAAATACCTTCAATAAGCAGTAAAGATGGTAG GGGGTTAAGAACAAAGTAGCTGTAGCCATGAATTACAGTATTACTATGTG CCTGTCTAGAGCAAAACAATGGTCATTCTGATCTCCCTGAAGGTCATTAC CATGAAGGTGAATTTGTTTCTAGCATACAATGTAGGAATTTCGACTTCTT ACTTCTTTACCTCTGGGTTGGTTCCTTAGCGACTGAGTCAGCTGTAAAAT TGAAGTTATAGTCAAAAATTATTTACATTGGGCCGAATAAAGAGAGTTAG CAAAAGTTAAAAGGATGCTAGACAAAACGTATTCAACTTTTCCTATACAA TGTATGTTAATTGGGTGACGGATAAACTGGTGGATGTACCAACGACATAA TACAATTAATGATTGTGTTTAAAAAATTGCCGTTTTCCTGAACTAATCGT AGAGGGGAACTTATTATGAACTAGAGTTTGGAGACCTCATATCTACATGA AATATTTTGATTAATATGCAAATGACTTTCACATTTACATGATTTATGCT TGGTCATGTACACCAGTCCTGTAACCGACTTACACAGGTCACAATGTTGA CAGTACAATCATTTACAACTTACATGTATAGATGAATTGTAACACTTTTG CATTTATCATGCAAATTAGGCATTTATTTGCATAATTGGTATCTGTTAAT GTTTCACCTGCCATAAACTATATCACTACCAAAAATGATTTTTCTTGTTT TTTCTTAACTCGTGGACAACTTTTCATATATTAAGAATTTCAAGAATGAA TAAGAAAGAAAAATTGAAGAATTTGTCTGATCTTTTCCATGGAAATTCTC ATAACAAGGAACACTTTCCTGATTCTATTAAGTTAAGAAACTATTTCTCA GCAAGTTTTTAACCATTAAGAATTTCTAGAAATCCAAGGCTGAATTTCTT GTTTTTATTAACTTCTAGATTATTTTTCTTGTTTTGTTAAGAAAAGATAA GATTTTTCTTTTCCCCTCTCTTGGATTATCTTGCTTCAAGACAAATTTTC TAAGAAAAAATTACTTAAAAAAAAAAATTCTCAACTCGTGGACAAAATGG TTTTCTTTAATACAGAAAGTTTTCTTCTTTTGAAAATTGTTTCCTGTGTA TAAGAAGCAACAAGAAAAATAAGAAAACTGATTTTTGGTAGTGATGTTAC ATGTATTTTAGTCCTATAATGGAAAACACTGCAAATATATATTTTCCTCA TTAGTTATGCAAATAAAGTTCCAATTTACATAGTTTGCACTTCATTGTGT AAATCTATGTCTAAGTTACCTGCATACTAAATATCATGGAAATCTGTCAT TCTTTTGTTCAGTTATTCTCCTTGGAAGATTTTGACATTTGACAACCCTG CAGTTCCAGAGCAAGCTGCTAGGGGGGCCCAAGCCTACACCACTTATTCC TTACATGTACATCACAACCTATCTGCCGCCAAAGAATCAAGACCCTAGTA CGTCCAGGTCAAAAGATACAAAAAATGGAAGTGCTGCTGCAGTACAAAGG TCACATACCAGGAGGACCAAAATCGACCTTGACCTTTGTCTACCCAACAC CTTCTAACATACCAAATATCACAATCCATCCAGAGGTTCTTGAGTTATGC TGACTACAATAGTCCAAAAAACACAGACACACAGACAGACACACACAGAC AGACACGCTCAAAACAATATTTCCATTTTTCATGGGGATAACAAGTACAG TTGGGACATCCTCACTAGATTCTAAACATTAAATAACGCTTGCAGCTACA GTAGTTTTGTAAAGAATCGGTGTGGGAGGTCATTCAGTGTAATATAACCT GCTGCTGCCGCACTGCATGTCTGCAAATCAGTTTTTTTTTAATCAAAAGA CGTCTTGTCTTTTTTTCTAGATGAAGATTTGGCCACTGGTATATGTCATC CATAGAATGTAATTGATGTGACTTTATCTGACATCGTGACCTAGATTTCA GCTGTGGGTGTGAGTAGCCTAGGGGGTAGGCTCCCTTACAGGAAATAAAT CATTCCTTGGATATTGTGATTCAATTTGTAACCTTTTTGCTGTGTGTTCC CAGGCCTGGAATAGAGGCCAACCTTTTGTACAATCATGTAAATCTGACTT CTACTGTTTTGAGGCGGTTTCTCATGATCAGAGCAGACATGGCCCGCAGG ATATCAACACATTAGCAAAAAGCACTTGGTCCCCCTTTACACTAGATGGC AATCACTGAGTGACTGTACAGCAACCAAAATTTGACTGTGTAACCCTTGA TTTCATGATTGGAATACAATGTATGTTACAATATCATCATCATTATCATC TACTGGTTTCTGCTTTTGTTGAAATGTCCTGCAGCTACATTCAGTCTTCT TCCACTGTGTCTTGCATCTTGCAATCAAGCTCCCATGCATTATGAGCTCT GGGAGTTTCCTTTCTGTTATAGGAGGGCCTTATTTTAAGTCTTCTGGTAC AATATGTATGATATATTAAAAGATATCCATGTTCACACAGAACATGAAAA GAATTTGTTCTGTGAAATCCGTTCAGCGATCTGTCAAATCTTTGGTTGGT CAGCGGTTGTAGTATAGCCTCTAGTGGAGAGGGGATGTTAATGAACAAAA CCCACATTGAAGTTCAGTGTAGATGATGAAAGGCAGCAGGCTCAACATTG AATGATTTATCATGATGTAGGCTAAGTTGGGTCCATCTGTAGCACATCTG GCAATACATCATTGACTGGCACAGATGTCAGCTTAACCAATGAAACTACA GTTTTATGTTTGTCAATGATGAGGCCTGTTCATGTATTGATTTCTCCAGC CTGTAATCATCACACTAAGAGGGATCAAAGGTTATGGACCTGATTACATA TATATGATATAATATTATCATATTTTTAAAAGCAAGAAAAGATTGTATTG AAACCAGTCATTCATGACTGATATAAAATCAGTTGATACAGTTTTGAATT CCAAGGGTGTGCTGTGGTGCTATGATACATGGCCATGATCTGTACCCTGA GCCATCCAACTTGTGTGCTGTGCCTACTAATCTAAAAGTATATTACTTGT ATTAGAGTTTCAAATAGTCAATGTTTGCCTGTAGTTGAGTACAGAAATTC CAGTTGTGCCCCTTGTTTGTACATGAGGCTTTAATTCAATTACATTTTGA ATACCCTTGTATGCAAATGCATCTTGTTCAACACAACCTACCACAGACTG TTTTGTCTGTAAAGAGCTAAATTTCTAACTCCAAATCTGTTGCCGGCAAA CTATCTAGCAAAGTAGAGCCGTTTTAGATCCCAGATGCCGTATGGAAGAC TGGAATACACTGTCTGACGTACGACAAGGCCGAGACATTACTGTGTCACC ATTGTACGGTAGAGACCTTTCCCTCACACATCCCTGACCCCCGTTGTTGA CCTCTTGACCCTCATACCTCACCTTGCTGTAGGCTCGTTCTACTAAGTCA TCCCAGAATTATGATGGTGACACAGTTGTCCATGGGCAAAGTCTTTCTTT TCACCTCCAAAGAATATACATGCAGTGTTCCAAAGGCATGCAGAGTAAGA GCAATGGGGTAAATTTGAGAGAGGTCAGGGTAAGAATGACCCTTATTTCA CTCCCATGACCCCCAGAACTTTTGATGGCCTGATGCCCTCCCTACCTTTA ATCATTGGCCAGATCTATTGGTCTGTTAGATATGGGAGAGTTAAAGATAC ATTAAGATTGTACAAAAGGTTGGGTCAGGGGTGAGGATGGTTTTATCTGG AGTCATGGGTGAGATATGCTTTACAGCAACATTTACCACAATTGTCACAA AAGCCATTGTGGTTCCATTGTAAAACAGGAGTATCATTATTGGACATGAA CAGTATTGCATTGTTAATATCAGAGTTGCTCTGTTCAGCCCTGGTTACAT ACATTGTACAATGCACCTAGATAGCATATCGCATGATGATCGCAGGTGAA TGGAAATTAAATCATAGTAAAATCAGCTATCACAGAGCGTCGGACAATGT TCAACATTTTTCCAGCATCATATGATTTTGGCGATGCTTCAGTGGCATGG TATAGTATTGTGTGCAGTTTGCAAATATTCTAGTAATTGCACAGGCATTT GTCTACAGGAATCTTAATCCCAGAAGAATGTTGAGCCCCTCCCACGCAAA AGTTTCTATCAAGTTTAACAATCATTATAGCTTTCAATCTGATACAGTTG CCGCCCTACCTTAAAGCACATTGCCTACATTTGTAAAACAACTGTACAAT GTACATGTACTTTACATCAAGAATTGTGATTTCAATAATGGGTTCTAAAA AGGAAGTGAGAAATTTAGAAATACTGATGGATACAGTACTTTAACCACTT ATTTAACTGTTACCATTACCTCAAGTGCATATTCCAAACACCAGTCTGAT GTCTTATAAAAGAATAGAATCTATATGAAAATGTCATATATTAAACAGTG AAAATTATGCATTTTGATGTAGGACTTGTCTTAATTTTGTGTTTTTTTAA ATATCTATTTCAGGCTGATATTCTGGACATCAATGAGGTCTTCAGGGACC TGGGGACCTTGGTACATGAACAAGGAGAGATGATAGGTGAGTACCAAAGA TGGGAATTTCATACTGGGTACTCTGTGTCTTATATATCCTTCTTTTAGAT TGAGCATCGCTTTCCTATTATGAAAATCAAAGGTAATAAAAATTCAGTTT TGGTTATGTTTGCTCAGAGATTGCTGTCTAGTGGAAATAGGGCATTAGCA GGTTTGCCTGCCTACATTTGTTAGCTGGATGATAAATGATAAAAACTACA GATGTTGTAACCCAAATGGTAACCTTCAAAATCACCCAAAAAATGCATAA TACAGAGATACAGTTAGAGAGTGTTTGATTTTTTGGGACCTGCATGTACT GTATAGTAAGAAATGGACCTGGAAGTTGGAAGGGGAGGGGGGCTTTATCA AGCATAATATGGGATCGCAATTTCTAAATGCAATGTTTCCTCTCATTGTG TGTCTTCACTCTCTATCCCTCATTCTATCTGTGCTGCATAATGTTGTCTG CATCTCATGTCAAAATTGAATTTTGCCATCAGAACTTCTTATGAACATTC TAACCTTTCGCCAACCTTTGAGCAAACTCATCAAGCCTTGTAGGTTCCAG TCCCATATCTCAGCTTGTAAGGAAGAGACACGCTTGATCACTACTGTGAC CCCTTACACACACACACACATTAGAAATTGACTGCCTGTCTTATATTACA ACCATGACTATCGTGTTAGCACACCTTCATACATCTCCCATGTTATTGCA GGATTTGAAGATTGTAAGTGAAAGCTGTTGGAAAG

Coding sequence (CDS) from alignment at Sc0000078:1127149..1152683+

>Blg00408.7 ID=Blg00408.7|Name=Blg00408.7|organism=Branchiostoma lanceolatum|type=CDS|length=762bp|location=Sequence derived from alignment at Sc0000078:1127149..1152683+ (Branchiostoma lanceolatum)
ATGAGCAGGGGAGAGTTTGGTGCGTATGGGTCTGTGGAGACAGGTGGTTT
TGACCGGAGAGACGACGGGTACGGTGTACCCAGGAGAGCCGGTTACCAGG
AGGATGGCTCTAACGATGTCAACCGTCTGTGTGAGCTGACGAGCACTAAC
ATATTCACCATCTCCAACAATGCCTCCTCCTTGGAGAAGACCCTGAAGCA
GATCGGTTCAGCCAATGACAGCCATCAGCTCAGGGACAGAGTCCACACCA
TGCAGCAGCAGACTAACCTGTTAGTGAGTGAGACTGCCAGGTGTCTGAAG
CAGCTGTCACAGATGACAAGGGGGGCTCCGAAGCCACAGAAGCTACAAGT
GGACAGACTAAGTAATGAGTTTAAGCAGAGTGTACAGAGATATGGCATCA
TTCAGAAGAGAGTAGCAGAGCAGTCCAGAATGAGTGTAGACACCATTAGG
AGTCCCAGCAGGGCTTCACAGGGTTTCCTGGATGATGACTATGGAGACGA
GTCCACCAGTCTGCTGGAGGAGGAGCAGCAGCGCAGGAGGGTGGAGGAGC
TGCAGAGGCAGGAACAGGTCATCGACTTCGAGGGGGACATCATCAGGGAG
AGGGAGGAGAGAATACGGGAAATCGAGGCTGATATTCTGGACATCAATGA
GGTCTTCAGGGACCTGGGGACCTTGGTACATGAACAAGGAGAGATGATAG
GTGAGTACCAAAGATGGGAATTTCATACTGGGTACTCTGTGTCTTATATA
TCCTTCTTTTAG
Gene-mRNA-Prot
The following exon feature(s) are a part of this mRNA:
Feature NameUnique NameSpeciesType
Blg00408.7-exon-Sc0000078-1570713199:1127149..1127248Blg00408.7-exon-Sc0000078-1570713199:1127149..1127248Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1136754..1136934Blg00408.7-exon-Sc0000078-1570713199:1136754..1136934Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1138006..1138075Blg00408.7-exon-Sc0000078-1570713199:1138006..1138075Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1139314..1139404Blg00408.7-exon-Sc0000078-1570713199:1139314..1139404Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1139714..1139788Blg00408.7-exon-Sc0000078-1570713199:1139714..1139788Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1140234..1140296Blg00408.7-exon-Sc0000078-1570713199:1140234..1140296Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1143369..1143524Blg00408.7-exon-Sc0000078-1570713199:1143369..1143524Branchiostoma lanceolatumexon
Blg00408.7-exon-Sc0000078-1570713199:1151862..1152683Blg00408.7-exon-Sc0000078-1570713199:1151862..1152683Branchiostoma lanceolatumexon
The following polypeptide feature(s) derives from this mRNA:
Feature NameUnique NameSpeciesType
Blg00408.7Blg00408.7-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000078genomeSc0000078:1127149..1152683 +
Properties
Property NameValue
GeneIDBlg00408